Human SGMS2/SMS2 ORF/cDNA clone-Lentivirus plasmid (NM_001136257)

Cat. No.: pGMLP001566
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SGMS2/SMS2 Lentiviral expression plasmid for SGMS2 lentivirus packaging, SGMS2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SGMS2/SMS2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $607.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001566
Gene Name SGMS2
Accession Number NM_001136257
Gene ID 166929
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1098 bp
Gene Alias SMS2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATATCATAGAGACAGCAAAACTTGAAGAACATTTGGAAAATCAACCCAGTGATCCTACGAACACTTATGCAAGACCCGCTGAACCTGTTGAAGAAGAAAACAAAAATGGCAATGGTAAACCCAAGAGCTTATCCAGTGGGCTGCGAAAAGGCACCAAAAAGTACCCGGACTATATCCAAATTGCTATGCCCACTGAATCAAGGAACAAATTTCCACTAGAGTGGTGGAAAACGGGCATTGCCTTCATATATGCAGTTTTCAACCTCGTCTTGACAACCGTCATGATCACAGTTGTACATGAGAGGGTCCCTCCCAAGGAGCTTAGCCCTCCACTCCCAGACAAGTTTTTTGATTACATTGATAGGGTGAAATGGGCATTTTCTGTATCAGAAATAAATGGGATTATATTAGTTGGATTATGGATCACCCAGTGGCTGTTTCTGAGATACAAGTCAATAGTGGGACGCAGATTCTGTTTTATTATTGGAACTTTATACCTGTATCGCTGCATTACAATGTATGTTACTACTCTACCTGTGCCTGGAATGCATTTCCAGTGTGCTCCAAAGCTCAATGGAGACTCTCAGGCAAAAGTTCAACGGATTCTACGATTGATTTCTGGTGGTGGATTGTCCATAACTGGATCACATATCTTATGTGGAGACTTCCTCTTCAGCGGTCACACGGTTACGCTGACACTGACTTATTTGTTCATCAAAGAATATTCGCCTCGTCACTTCTGGTGGTATCATTTAATCTGCTGGCTGCTGAGTGCTGCCGGGATCATCTGCATTCTTGTAGCACACGAACACTACACTATCGATGTGATCATTGCTTATTATATCACAACACGACTGTTTTGGTGGTACCATTCAATGGCCAATGAAAAGAACTTGAAGGTCTCTTCACAGACTAATTTCTTATCTCGAGCATGGTGGTTCCCCATCTTTTATTTTTTTGAGAAAAATGTACAAGGCTCAATTCCTTGCTGCTTCTCCTGGCCGCTGTCTTGGCCTCCTGGCTGCTTCAAATCATCATGCAAAAAGTATTCACGGGTTCAGAAGATTGGTGAAGACAATGAGAAATCGACCTGA
ORF Protein Sequence MDIIETAKLEEHLENQPSDPTNTYARPAEPVEEENKNGNGKPKSLSSGLRKGTKKYPDYIQIAMPTESRNKFPLEWWKTGIAFIYAVFNLVLTTVMITVVHERVPPKELSPPLPDKFFDYIDRVKWAFSVSEINGIILVGLWITQWLFLRYKSIVGRRFCFIIGTLYLYRCITMYVTTLPVPGMHFQCAPKLNGDSQAKVQRILRLISGGGLSITGSHILCGDFLFSGHTVTLTLTYLFIKEYSPRHFWWYHLICWLLSAAGIICILVAHEHYTIDVIIAYYITTRLFWWYHSMANEKNLKVSSQTNFLSRAWWFPIFYFFEKNVQGSIPCCFSWPLSWPPGCFKSSCKKYSRVQKIGEDNEKST

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA108-Ab Anti-SMS2/ SGMS2 monoclonal antibody
    Target Antigen GM-Tg-g-TA108-Ag SGMS2 VLP (virus-like particle)
    ORF Viral Vector pGMLP001566 Human SGMS2 Lentivirus plasmid
    ORF Viral Vector vGMLP001566 Human SGMS2 Lentivirus particle


    Target information

    Target ID GM-TA108
    Target Name SGMS2
    Gene ID 166929, 74442, 695947, 310849, 101088574, 478505, 520954, 100072971
    Gene Symbol and Synonyms 4933405A16Rik,5133401H06Rik,CDL,RGD1305778,SGMS2,SMS2,spermatin
    Uniprot Accession Q8NHU3
    Uniprot Entry Name SMS2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000164023
    Target Classification Not Available

    Sphingomyelin, a major component of cell and Golgi membranes, is made by the transfer of phosphocholine from phosphatidylcholine onto ceramide, with diacylglycerol as a side product. The protein encoded by this gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The synthesis is reversible, and this enzyme can catalyze the reaction in either direction. The encoded protein is required for cell growth. Three transcript variants encoding the same protein have been found for this gene. There is evidence for more variants, but the full-length nature of their transcripts has not been determined.[provided by RefSeq, Oct 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.