Human TACR1/NK1R/ NKIR ORF/cDNA clone-Lentivirus plasmid (NM_001058)
Pre-made Human TACR1/NK1R/ NKIR Lentiviral expression plasmid for TACR1 lentivirus packaging, TACR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TACR1/NK1R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001583 | Human TACR1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001583 |
Gene Name | TACR1 |
Accession Number | NM_001058 |
Gene ID | 6869 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1224 bp |
Gene Alias | NK1R, NKIR, SPR, TAC1R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATAACGTCCTCCCGGTGGACTCAGACCTCTCCCCAAACATCTCCACTAACACCTCGGAACCCAATCAGTTCGTGCAACCAGCCTGGCAAATTGTCCTTTGGGCAGCTGCCTACACGGTCATTGTGGTGACCTCTGTGGTGGGCAACGTGGTAGTGATGTGGATCATCTTAGCCCACAAAAGAATGAGGACAGTGACGAACTATTTTCTGGTGAACCTGGCCTTCGCGGAGGCCTCCATGGCTGCATTCAATACAGTGGTGAACTTCACCTATGCTGTCCACAACGAATGGTACTACGGCCTGTTCTACTGCAAGTTCCACAACTTCTTTCCCATCGCCGCTGTCTTCGCCAGTATCTACTCCATGACGGCTGTGGCCTTTGATAGGTACATGGCCATCATACATCCCCTCCAGCCCCGGCTGTCAGCCACAGCCACCAAAGTGGTCATCTGTGTCATCTGGGTCCTGGCTCTCCTGCTGGCCTTCCCCCAGGGCTACTACTCAACCACAGAGACCATGCCCAGCAGAGTCGTGTGCATGATCGAATGGCCAGAGCATCCGAACAAGATTTATGAGAAAGTGTACCACATCTGTGTGACTGTGCTGATCTACTTCCTCCCCCTGCTGGTGATTGGCTATGCATACACCGTAGTGGGAATCACACTATGGGCCAGTGAGATCCCCGGGGACTCCTCTGACCGCTACCACGAGCAAGTCTCTGCCAAGCGCAAGGTGGTCAAAATGATGATTGTCGTGGTGTGCACCTTCGCCATCTGCTGGCTGCCCTTCCACATCTTCTTCCTCCTGCCCTACATCAACCCAGATCTCTACCTGAAGAAGTTTATCCAGCAGGTCTACCTGGCCATCATGTGGCTGGCCATGAGCTCCACCATGTACAACCCCATCATCTACTGCTGCCTCAATGACAGGTTCCGTCTGGGCTTCAAGCATGCCTTCCGGTGCTGCCCCTTCATCAGCGCCGGCGACTATGAGGGGCTGGAAATGAAATCCACCCGGTATCTCCAGACCCAGGGCAGTGTGTACAAAGTCAGCCGCCTGGAGACCACCATCTCCACAGTGGTGGGGGCCCACGAGGAGGAGCCAGAGGACGGCCCCAAGGCCACACCCTCGTCCCTGGACCTGACCTCCAACTGCTCTTCACGAAGTGACTCCAAGACCATGACAGAGAGCTTCAGCTTCTCCTCCAATGTGCTCTCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T47094-Ab | Anti-NK1R/ TACR1/ NKIR monoclonal antibody |
Target Antigen | GM-Tg-g-T47094-Ag | TACR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001583 | Human TACR1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001583 | Human TACR1 Lentivirus particle |
Target information
Target ID | GM-T47094 |
Target Name | TACR1 |
Gene ID | 6869, 21336, 653008, 24807, 101090094, 403815, 407133, 100053491 |
Gene Symbol and Synonyms | NK-1,NK1R,NKIR,SPR,TAC1R,TACR1 |
Uniprot Accession | P25103 |
Uniprot Entry Name | NK1R_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000115353 |
Target Classification | GPCR, Tumor-associated antigen (TAA) |
This gene belongs to a gene family of tachykinin receptors. These tachykinin receptors are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin substance P, also referred to as neurokinin 1. The encoded protein is also involved in the mediation of phosphatidylinositol metabolism of substance P. [provided by RefSeq, Sep 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.