Human TACR1/NK1R/ NKIR ORF/cDNA clone-Lentivirus plasmid (NM_001058)

Pre-made Human TACR1/NK1R/ NKIR Lentiviral expression plasmid for TACR1 lentivirus packaging, TACR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TACR1/NK1R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001583 Human TACR1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001583
Gene Name TACR1
Accession Number NM_001058
Gene ID 6869
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1224 bp
Gene Alias NK1R, NKIR, SPR, TAC1R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATAACGTCCTCCCGGTGGACTCAGACCTCTCCCCAAACATCTCCACTAACACCTCGGAACCCAATCAGTTCGTGCAACCAGCCTGGCAAATTGTCCTTTGGGCAGCTGCCTACACGGTCATTGTGGTGACCTCTGTGGTGGGCAACGTGGTAGTGATGTGGATCATCTTAGCCCACAAAAGAATGAGGACAGTGACGAACTATTTTCTGGTGAACCTGGCCTTCGCGGAGGCCTCCATGGCTGCATTCAATACAGTGGTGAACTTCACCTATGCTGTCCACAACGAATGGTACTACGGCCTGTTCTACTGCAAGTTCCACAACTTCTTTCCCATCGCCGCTGTCTTCGCCAGTATCTACTCCATGACGGCTGTGGCCTTTGATAGGTACATGGCCATCATACATCCCCTCCAGCCCCGGCTGTCAGCCACAGCCACCAAAGTGGTCATCTGTGTCATCTGGGTCCTGGCTCTCCTGCTGGCCTTCCCCCAGGGCTACTACTCAACCACAGAGACCATGCCCAGCAGAGTCGTGTGCATGATCGAATGGCCAGAGCATCCGAACAAGATTTATGAGAAAGTGTACCACATCTGTGTGACTGTGCTGATCTACTTCCTCCCCCTGCTGGTGATTGGCTATGCATACACCGTAGTGGGAATCACACTATGGGCCAGTGAGATCCCCGGGGACTCCTCTGACCGCTACCACGAGCAAGTCTCTGCCAAGCGCAAGGTGGTCAAAATGATGATTGTCGTGGTGTGCACCTTCGCCATCTGCTGGCTGCCCTTCCACATCTTCTTCCTCCTGCCCTACATCAACCCAGATCTCTACCTGAAGAAGTTTATCCAGCAGGTCTACCTGGCCATCATGTGGCTGGCCATGAGCTCCACCATGTACAACCCCATCATCTACTGCTGCCTCAATGACAGGTTCCGTCTGGGCTTCAAGCATGCCTTCCGGTGCTGCCCCTTCATCAGCGCCGGCGACTATGAGGGGCTGGAAATGAAATCCACCCGGTATCTCCAGACCCAGGGCAGTGTGTACAAAGTCAGCCGCCTGGAGACCACCATCTCCACAGTGGTGGGGGCCCACGAGGAGGAGCCAGAGGACGGCCCCAAGGCCACACCCTCGTCCCTGGACCTGACCTCCAACTGCTCTTCACGAAGTGACTCCAAGACCATGACAGAGAGCTTCAGCTTCTCCTCCAATGTGCTCTCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47094-Ab Anti-NK1R/ TACR1/ NKIR monoclonal antibody
    Target Antigen GM-Tg-g-T47094-Ag TACR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001583 Human TACR1 Lentivirus plasmid
    ORF Viral Vector vGMLP001583 Human TACR1 Lentivirus particle


    Target information

    Target ID GM-T47094
    Target Name TACR1
    Gene ID 6869, 21336, 653008, 24807, 101090094, 403815, 407133, 100053491
    Gene Symbol and Synonyms NK-1,NK1R,NKIR,SPR,TAC1R,TACR1
    Uniprot Accession P25103
    Uniprot Entry Name NK1R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000115353
    Target Classification GPCR, Tumor-associated antigen (TAA)

    This gene belongs to a gene family of tachykinin receptors. These tachykinin receptors are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin substance P, also referred to as neurokinin 1. The encoded protein is also involved in the mediation of phosphatidylinositol metabolism of substance P. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.