Human GAS1 ORF/cDNA clone-Lentivirus plasmid (NM_002048)

Cat. No.: pGMLP001650
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GAS1/ Lentiviral expression plasmid for GAS1 lentivirus packaging, GAS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GAS1/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $590.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001650
Gene Name GAS1
Accession Number NM_002048
Gene ID 2619
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1038 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGGCCGCGCTGCTGGGCGGCGGCGGCGAGGCCCGCGGGGGGACAGTGCCGGGCGCCTGGCTGTGCCTGATGGCGCTGCTGCAGCTGCTGGGCTCGGCGCCGCGGGGATCGGGGCTGGCGCACGGCCGCCGCCTCATCTGCTGGCAGGCGCTGCTGCAGTGCCAGGGGGAGCCGGAGTGCAGCTACGCCTACAACCAGTACGCCGAGGCGTGCGCGCCGGTGCTGGCGCAGCACGGCGGGGGCGACGCGCCCGGGGCCGCCGCCGCCGCTTTCCCGGCCTCGGCCGCCTCTTTCTCGTCGCGCTGGCGCTGCCCGAGTCACTGCATCTCGGCCCTCATTCAGCTCAACCACACGCGCCGCGGGCCCGCCCTGGAGGACTGTGACTGCGCGCAGGACGAGAACTGCAAGTCCACCAAGCGCGCCATTGAGCCGTGCCTGCCCCGGACGAGCGGCGGCGGCGCGGGCGGCCCCGGCGCGGGCGGGGTCATGGGCTGCACCGAGGCCCGGCGGCGCTGCGACCGCGACAGCCGCTGCAACCTGGCGCTGAGCCGCTACCTGACCTACTGCGGCAAAGTCTTCAACGGGCTGCGCTGCACGGACGAATGCCGCACCGTCATTGAGGACATGCTGGCTATGCCCAAGGCGGCGCTGCTCAACGACTGCGTGTGCGACGGCCTCGAGCGGCCCATCTGCGAGTCGGTCAAGGAGAACATGGCCCGCCTGTGCTTCGGCGCCGAGCTGGGCAACGGCCCCGGCAGCAGCGGCTCGGACGGGGGCCTGGACGACTACTACGATGAGGACTACGATGACGAGCAGCGCACCGGGGGCGCGGGTGGTGAGCAGCCGCTGGACGACGACGACGGCGTCCCGCACCCACCGCGCCCGGGCAGCGGCGCTGCTGCATCGGGCGGCCGCGGGGACCTGCCCTATGGGCCTGGGCGCAGGAGCAGCGGCGGCGGCGGCCGCTTGGCGCCCCGGGGCGCCTGGACCCCACTCGCCTCCATCTTGCTGCTGCTGCTTGGGCCGCTCTTTTAG
ORF Protein Sequence MVAALLGGGGEARGGTVPGAWLCLMALLQLLGSAPRGSGLAHGRRLICWQALLQCQGEPECSYAYNQYAEACAPVLAQHGGGDAPGAAAAAFPASAASFSSRWRCPSHCISALIQLNHTRRGPALEDCDCAQDENCKSTKRAIEPCLPRTSGGGAGGPGAGGVMGCTEARRRCDRDSRCNLALSRYLTYCGKVFNGLRCTDECRTVIEDMLAMPKAALLNDCVCDGLERPICESVKENMARLCFGAELGNGPGSSGSDGGLDDYYDEDYDDEQRTGGAGGEQPLDDDDGVPHPPRPGSGAAASGGRGDLPYGPGRRSSGGGGRLAPRGAWTPLASILLLLLGPLF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0474-Ab Anti-GAS1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0474-Ag GAS1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001650 Human GAS1 Lentivirus plasmid
    ORF Viral Vector vGMLP001650 Human GAS1 Lentivirus particle


    Target information

    Target ID GM-MP0474
    Target Name GAS1
    Gene ID 2619, 14451, 694650, 683470, 105261094, 607496, 540336, 111770133
    Gene Symbol and Synonyms Gas-1,GAS1
    Uniprot Accession P54826
    Uniprot Entry Name GAS1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000180447
    Target Classification Not Available

    Growth arrest-specific 1 plays a role in growth suppression.  GAS1 blocks entry to S phase and prevents cycling of normal and transformed cells.  Gas1 is a putative tumor suppressor gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.