Human LTB4R2/BLT2/BLTR2 ORF/cDNA clone-Lentivirus plasmid (NM_001164692)

Cat. No.: pGMLP001685
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LTB4R2/BLT2/BLTR2 Lentiviral expression plasmid for LTB4R2 lentivirus packaging, LTB4R2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LTB4R2/BLT2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $601.56
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001685
Gene Name LTB4R2
Accession Number NM_001164692
Gene ID 56413
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1077 bp
Gene Alias BLT2,BLTR2,JULF2,KPG_004,LTB4-R 2,LTB4-R2,NOP9
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGGTCTGCTACCGTCCCCCAGGGAACGAGACACTGCTGAGCTGGAAGACTTCGCGGGCCACAGGCACAGCCTTCCTGCTGCTGGCGGCGCTGCTGGGGCTGCCTGGCAACGGCTTCGTGGTGTGGAGCTTGGCGGGCTGGCGGCCTGCACGGGGGCGACCGCTGGCGGCCACGCTTGTGCTGCACCTGGCGCTGGCCGACGGCGCGGTGCTGCTGCTCACGCCGCTCTTTGTGGCCTTCCTGACCCGGCAGGCCTGGCCGCTGGGCCAGGCGGGCTGCAAGGCGGTGTACTACGTGTGCGCGCTCAGCATGTACGCCAGCGTGCTGCTCACCGGCCTGCTCAGCCTGCAGCGCTGCCTCGCAGTCACCCGCCCCTTCCTGGCGCCTCGGCTGCGCAGCCCGGCCCTGGCCCGCCGCCTGCTGCTGGCGGTCTGGCTGGCCGCCCTGTTGCTCGCCGTCCCGGCCGCCGTCTACCGCCACCTGTGGAGGGACCGCGTATGCCAGCTGTGCCACCCGTCGCCGGTCCACGCCGCCGCCCACCTGAGCCTGGAGACTCTGACCGCTTTCGTGCTTCCTTTCGGGCTGATGCTCGGCTGCTACAGCGTGACGCTGGCACGGCTGCGGGGCGCCCGCTGGGGCTCCGGGCGGCACGGGGCGCGGGTGGGCCGGCTGGTGAGCGCCATCGTGCTTGCCTTCGGCTTGCTCTGGGCCCCCTACCACGCAGTCAACCTTCTGCAGGCGGTCGCAGCGCTGGCTCCACCGGAAGGGGCCTTGGCGAAGCTGGGCGGAGCCGGCCAGGCGGCGCGAGCGGGAACTACGGCCTTGGCCTTCTTCAGTTCTAGCGTCAACCCGGTGCTCTACGTCTTCACCGCTGGAGATCTGCTGCCCCGGGCAGGTCCCCGTTTCCTCACGCGGCTCTTCGAAGGCTCTGGGGAGGCCCGAGGGGGCGGCCGCTCTAGGGAAGGGACCATGGAGCTCCGAACTACCCCTCAGCTGAAAGTGGTGGGGCAGGGCCGCGGCAATGGAGACCCGGGGGGTGGGATGGAGAAGGACGGTCCGGAATGGGACCTTTGA
ORF Protein Sequence MSVCYRPPGNETLLSWKTSRATGTAFLLLAALLGLPGNGFVVWSLAGWRPARGRPLAATLVLHLALADGAVLLLTPLFVAFLTRQAWPLGQAGCKAVYYVCALSMYASVLLTGLLSLQRCLAVTRPFLAPRLRSPALARRLLLAVWLAALLLAVPAAVYRHLWRDRVCQLCHPSPVHAAAHLSLETLTAFVLPFGLMLGCYSVTLARLRGARWGSGRHGARVGRLVSAIVLAFGLLWAPYHAVNLLQAVAALAPPEGALAKLGGAGQAARAGTTALAFFSSSVNPVLYVFTAGDLLPRAGPRFLTRLFEGSGEARGGGRSREGTMELRTTPQLKVVGQGRGNGDPGGGMEKDGPEWDL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T30563-Ab Anti-LT4R2/ LTB4R2/ BLT2 monoclonal antibody
    Target Antigen GM-Tg-g-T30563-Ag LTB4R2 VLP (virus-like particle)
    ORF Viral Vector pGMLP001685 Human LTB4R2 Lentivirus plasmid
    ORF Viral Vector vGMLP001685 Human LTB4R2 Lentivirus particle


    Target information

    Target ID GM-T30563
    Target Name LTB4R2
    Gene ID 56413, 57260, 716012, 114098, 111560862, 490624, 513386
    Gene Symbol and Synonyms 5830462O07Rik,BLT2,BLTR2,JULF2,KPG_004,LTB4-R 2,LTB4-R-2,LTB4-R2,LTB4R2,NOP9
    Uniprot Accession Q9NPC1
    Uniprot Entry Name LT4R2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000213906
    Target Classification Not Available

    Predicted to enable G protein-coupled peptide receptor activity and leukotriene B4 receptor activity. Predicted to be involved in inflammatory response and neuropeptide signaling pathway. Predicted to act upstream of or within keratinocyte migration and signal transduction. Located in nucleoplasm and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.