Human POGLUT1/C3orf9/ CLP46 ORF/cDNA clone-Lentivirus plasmid (NM_152305)

Pre-made Human POGLUT1/C3orf9/ CLP46 Lentiviral expression plasmid for POGLUT1 lentivirus packaging, POGLUT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to POGLUT1/C3orf9 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001717 Human POGLUT1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001717
Gene Name POGLUT1
Accession Number NM_152305
Gene ID 56983
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1179 bp
Gene Alias C3orf9, CLP46, hCLP46, KDELCL1, KTELC1, LGMD2Z, MDS010, MDSRP, Rumi
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGTGGTGGGCTAGCTCGCCGCTTCGGCTCTGGCTGCTGTTGTTCCTCCTGCCCTCAGCGCAGGGCCGCCAGAAGGAGTCAGGTTCAAAATGGAAAGTATTTATTGACCAAATTAACAGGTCTTTGGAGAATTACGAACCATGTTCAAGTCAAAACTGCAGCTGCTACCATGGTGTCATAGAAGAGGATCTAACTCCTTTCCGAGGAGGCATCTCCAGGAAGATGATGGCAGAGGTAGTCAGACGGAAGCTAGGGACCCACTATCAGATCACTAAGAACAGACTGTACCGGGAAAATGACTGCATGTTCCCCTCAAGGTGTAGTGGTGTTGAGCACTTTATTTTGGAAGTGATCGGGCGTCTCCCTGACATGGAGATGGTGATCAATGTACGAGATTATCCTCAGGTTCCTAAATGGATGGAGCCTGCCATCCCAGTCTTCTCCTTCAGTAAGACATCAGAGTACCATGATATCATGTATCCTGCTTGGACATTTTGGGAAGGGGGACCTGCTGTTTGGCCAATTTATCCTACAGGTCTTGGACGGTGGGACCTCTTCAGAGAAGATCTGGTAAGGTCAGCAGCACAGTGGCCATGGAAAAAGAAAAACTCTACAGCATATTTCCGAGGATCAAGGACAAGTCCAGAACGAGATCCTCTCATTCTTCTGTCTCGGAAAAACCCAAAACTTGTTGATGCAGAATACACCAAAAACCAGGCCTGGAAATCTATGAAAGATACCTTAGGAAAGCCAGCTGCTAAGGATGTCCATCTTGTGGATCACTGCAAATACAAGTATCTGTTTAATTTTCGAGGCGTAGCTGCAAGTTTCCGGTTTAAACACCTCTTCCTGTGTGGCTCACTTGTTTTCCATGTTGGTGATGAGTGGCTAGAATTCTTCTATCCACAGCTGAAGCCATGGGTTCACTATATCCCAGTCAAAACAGATCTCTCCAATGTCCAAGAGCTGTTACAATTTGTAAAAGCAAATGATGATGTAGCTCAAGAGATTGCTGAAAGGGGAAGCCAGTTTATTAGGAACCATTTGCAGATGGATGACATCACCTGTTACTGGGAGAACCTCTTGAGTGAATACTCTAAATTCCTGTCTTATAATGTAACGAGAAGGAAAGGTTATGATCAAATTATTCCCAAAATGTTGAAAACTGAACTATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1561-Ab Anti-PGLT1/ POGLUT1/ C3orf9 functional antibody
    Target Antigen GM-Tg-g-SE1561-Ag POGLUT1 protein
    ORF Viral Vector pGMLP001717 Human POGLUT1 Lentivirus plasmid
    ORF Viral Vector vGMLP001717 Human POGLUT1 Lentivirus particle


    Target information

    Target ID GM-SE1561
    Target Name POGLUT1
    Gene ID 56983, 224143, 712357, 288091, 101088101, 487993, 511862, 100071030
    Gene Symbol and Synonyms 9630046K23Rik,C3orf9,CLP46,hCLP46,KDELCL1,KTELC1,LGMD2Z,LGMDR21,MDS010,MDSRP,POGLUT1,RGD1306248,Rumi,wsnp
    Uniprot Accession Q8NBL1
    Uniprot Entry Name PGLT1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163389
    Target Classification Not Available

    This gene encodes a protein with both O-glucosyltransferase and O-xylosyltransferase activity which localizes to the lumen of the endoplasmic reticulum. This protein has a carboxy-terminal KTEL motif which is predicted to function as an endoplasmic reticulum retention signal. This gene is an essential regulator of Notch signalling and likely plays a role in cell fate and tissue formation during development. It may also play a role in the pathogenesis of leukemia. Mutations in this gene have been associated with the autosomal dominant genodermatosis Dowling-Degos disease 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.