Human UTS2R/GPR14/UR-2-R ORF/cDNA clone-Lentivirus plasmid (NM_018949)

Cat. No.: pGMLP001756
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human UTS2R/GPR14/UR-2-R Lentiviral expression plasmid for UTS2R lentivirus packaging, UTS2R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to UTS2R/GPR14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $627.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001756
Gene Name UTS2R
Accession Number NM_018949
Gene ID 2837
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1170 bp
Gene Alias GPR14,UR-2-R,UTR,UTR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCTGACCCCCGAGTCCCCGAGCAGCTTCCCTGGGCTGGCCGCCACTGGCAGCTCTGTGCCGGAGCCGCCTGGCGGCCCCAACGCAACCCTCAACAGCTCCTGGGCCAGCCCGACCGAGCCCAGCTCCCTGGAGGACCTGGTGGCCACGGGCACCATTGGGACTCTGCTGTCGGCCATGGGCGTGGTGGGCGTGGTGGGCAACGCCTACACGCTGGTGGTCACCTGCCGCTCCCTGCGTGCGGTGGCCTCCATGTACGTCTACGTGGTCAACCTGGCGCTGGCCGACCTGCTGTACCTGCTCAGCATCCCCTTCATCGTGGCCACCTACGTCACCAAGGAGTGGCACTTCGGGGACGTGGGCTGCCGCGTGCTCTTCGGCCTGGACTTCCTGACCATGCACGCCAGCATCTTCACGCTGACCGTCATGAGCAGCGAGCGCTACGCTGCGGTGCTGCGGCCGCTGGACACCGTGCAGCGCCCCAAGGGCTACCGCAAGCTGCTGGCGCTGGGCACCTGGCTGCTGGCGCTGCTGCTGACGCTGCCCGTGATGCTGGCCATGCGGCTGGTGCGCCGGGGTCCCAAGAGCCTGTGCCTGCCCGCCTGGGGCCCGCGCGCCCACCGCGCCTACCTGACGCTGCTCTTCGCCACCAGCATCGCGGGGCCCGGGCTGCTCATCGGGCTGCTCTACGCGCGCCTGGCCCGCGCCTACCGCCGCTCGCAGCGCGCCTCCTTCAAGCGGGCCCGGCGGCCGGGGGCGCGCGCGCTGCGCCTGGTGCTGGGCATCGTGCTGCTCTTCTGGGCCTGCTTCCTGCCCTTCTGGCTGTGGCAGCTGCTCGCCCAGTACCACCAGGCCCCGCTGGCGCCGCGGACGGCGCGCATCGTCAACTACCTGACCACCTGCCTCACCTACGGCAACAGCTGCGCCAACCCCTTCCTCTACACGCTGCTCACCAGGAACTACCGCGACCACCTGCGCGGCCGCGTGCGGGGCCCGGGCAGCGGGGGAGGCCGGGGGCCCGTTCCCTCCCTGCAGCCCCGCGCCCGCTTCCAGCGCTGTTCGGGCCGCTCCCTGTCTTCCTGCAGCCCACAGCCCACTGACAGCCTCGTGCTGGCCCCAGCGGCCCCGGCCCGACCTGCGCCCGAGGGTCCCAGGGCCCCGGCGTGA
ORF Protein Sequence MALTPESPSSFPGLAATGSSVPEPPGGPNATLNSSWASPTEPSSLEDLVATGTIGTLLSAMGVVGVVGNAYTLVVTCRSLRAVASMYVYVVNLALADLLYLLSIPFIVATYVTKEWHFGDVGCRVLFGLDFLTMHASIFTLTVMSSERYAAVLRPLDTVQRPKGYRKLLALGTWLLALLLTLPVMLAMRLVRRGPKSLCLPAWGPRAHRAYLTLLFATSIAGPGLLIGLLYARLARAYRRSQRASFKRARRPGARALRLVLGIVLLFWACFLPFWLWQLLAQYHQAPLAPRTARIVNYLTTCLTYGNSCANPFLYTLLTRNYRDHLRGRVRGPGSGGGRGPVPSLQPRARFQRCSGRSLSSCSPQPTDSLVLAPAAPARPAPEGPRAPA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T49072-Ab Anti-UR2R/ UTS2R/ GPR14 monoclonal antibody
    Target Antigen GM-Tg-g-T49072-Ag UTS2R VLP (virus-like particle)
    ORF Viral Vector pGMLP001756 Human UTS2R Lentivirus plasmid
    ORF Viral Vector vGMLP001756 Human UTS2R Lentivirus particle


    Target information

    Target ID GM-T49072
    Target Name UTS2R
    Gene ID 2837, 217369, 574245, 57305, 554343, 491678, 286969, 100056872
    Gene Symbol and Synonyms GPR14,Senr,UR-2-R,UTR,UTR2,UTS2R
    Uniprot Accession Q9UKP6
    Uniprot Entry Name UR2R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000181408
    Target Classification GPCR

    Predicted to enable urotensin II receptor activity. Predicted to be involved in neuropeptide signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.