Human ART1/ART2/ARTC1 ORF/cDNA clone-Lentivirus plasmid (NM_004314)

Cat. No.: pGMLP001859
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ART1/ART2/ARTC1 Lentiviral expression plasmid for ART1 lentivirus packaging, ART1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ART1/ART2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $546
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001859
Gene Name ART1
Accession Number NM_004314
Gene ID 417
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 984 bp
Gene Alias ART2,ARTC1,CD296,RT6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGATGCCTGCTATGATGTCTCTGCTTCTTGTGTCTGTGGGCCTCATGGAAGCACTTCAGGCCCAGAGCCACCCCATCACACGACGAGACCTCTTCTCTCAAGAGATTCAGCTGGACATGGCCCTGGCCTCCTTTGATGACCAGTACGCTGGCTGTGCTGCTGCCATGACAGCTGCTCTCCCGGATCTCAACCACACGGAGTTCCAGGCCAACCAGGTGTATGCAGACAGCTGGACACTGGCAAGCAGCCAATGGCAGGAGCGTCAGGCCAGGTGGCCAGAGTGGAGTCTCAGCCCCACCCGTCCATCCCCGCCACCCCTGGGCTTCCGCGATGAGCATGGGGTGGCCCTCCTGGCCTACACAGCCAACAGCCCCCTGCACAAGGAGTTCAATGCAGCCGTGCGTGAGGCGGGCCGCTCCCGGGCCCACTACCTCCACCACTTCTCCTTCAAGACACTCCATTTCCTGCTGACTGAGGCCCTGCAGCTCCTGGGCAGCGGCCAGCGTCCACCCCGGTGCCACCAGGTGTTCCGAGGTGTGCACGGCCTGCGCTTCCGGCCAGCAGGGCCCCGGGCCACCGTGAGGCTGGGGGGCTTTGCTTCTGCCTCCCTGAAGCATGTTGCAGCCCAGCAGTTTGGTGAGGACACCTTCTTCGGCATCTGGACCTGCCTTGGGGCCCCTATCAAGGGCTACTCCTTCTTCCCTGGAGAGGAAGAGGTGCTGATCCCCCCCTTTGAGACCTTCCAAGTGATCAATGCCAGCAGACTGGCCCAGGGCCCCGCCCGCATCTACCTCCGAGCCCTGGGCAAGCACAGCACCTACAACTGCGAGTACATCAAAGACAAGAAGTGCAAGTCTGGGCCTTGCCATCTGGATAATTCAGCCATGGGTCAGAGCCCCCTCTCTGCAGTCTGGTCTTTGCTGCTGCTGCTCTGGTTCCTCGTGGTGAGGGCCTTTCCAGATGGTCCAGGCCTCCTTTGA
ORF Protein Sequence MQMPAMMSLLLVSVGLMEALQAQSHPITRRDLFSQEIQLDMALASFDDQYAGCAAAMTAALPDLNHTEFQANQVYADSWTLASSQWQERQARWPEWSLSPTRPSPPPLGFRDEHGVALLAYTANSPLHKEFNAAVREAGRSRAHYLHHFSFKTLHFLLTEALQLLGSGQRPPRCHQVFRGVHGLRFRPAGPRATVRLGGFASASLKHVAAQQFGEDTFFGIWTCLGAPIKGYSFFPGEEEVLIPPFETFQVINASRLAQGPARIYLRALGKHSTYNCEYIKDKKCKSGPCHLDNSAMGQSPLSAVWSLLLLLWFLVVRAFPDGPGLL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0086-Ab Anti-NAR1/ ART1/ ART2 monoclonal antibody
    Target Antigen GM-Tg-g-MP0086-Ag ART1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001859 Human ART1 Lentivirus plasmid
    ORF Viral Vector vGMLP001859 Human ART1 Lentivirus particle


    Target information

    Target ID GM-MP0086
    Target Name ART1
    Gene ID 417, 11870, 718154, 308873, 101086418, 476821, 100052937
    Gene Symbol and Synonyms ADPRT,ART1,ART2,ARTC1,CD296,RT6,Yac-1
    Uniprot Accession P52961
    Uniprot Entry Name NAR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000129744
    Target Classification Not Available

    ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.