Human ART1/ART2/ARTC1 ORF/cDNA clone-Lentivirus plasmid (NM_004314)
Cat. No.: pGMLP001859
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human ART1/ART2/ARTC1 Lentiviral expression plasmid for ART1 lentivirus packaging, ART1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
ART1/ART2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001859 |
Gene Name | ART1 |
Accession Number | NM_004314 |
Gene ID | 417 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 984 bp |
Gene Alias | ART2,ARTC1,CD296,RT6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCAGATGCCTGCTATGATGTCTCTGCTTCTTGTGTCTGTGGGCCTCATGGAAGCACTTCAGGCCCAGAGCCACCCCATCACACGACGAGACCTCTTCTCTCAAGAGATTCAGCTGGACATGGCCCTGGCCTCCTTTGATGACCAGTACGCTGGCTGTGCTGCTGCCATGACAGCTGCTCTCCCGGATCTCAACCACACGGAGTTCCAGGCCAACCAGGTGTATGCAGACAGCTGGACACTGGCAAGCAGCCAATGGCAGGAGCGTCAGGCCAGGTGGCCAGAGTGGAGTCTCAGCCCCACCCGTCCATCCCCGCCACCCCTGGGCTTCCGCGATGAGCATGGGGTGGCCCTCCTGGCCTACACAGCCAACAGCCCCCTGCACAAGGAGTTCAATGCAGCCGTGCGTGAGGCGGGCCGCTCCCGGGCCCACTACCTCCACCACTTCTCCTTCAAGACACTCCATTTCCTGCTGACTGAGGCCCTGCAGCTCCTGGGCAGCGGCCAGCGTCCACCCCGGTGCCACCAGGTGTTCCGAGGTGTGCACGGCCTGCGCTTCCGGCCAGCAGGGCCCCGGGCCACCGTGAGGCTGGGGGGCTTTGCTTCTGCCTCCCTGAAGCATGTTGCAGCCCAGCAGTTTGGTGAGGACACCTTCTTCGGCATCTGGACCTGCCTTGGGGCCCCTATCAAGGGCTACTCCTTCTTCCCTGGAGAGGAAGAGGTGCTGATCCCCCCCTTTGAGACCTTCCAAGTGATCAATGCCAGCAGACTGGCCCAGGGCCCCGCCCGCATCTACCTCCGAGCCCTGGGCAAGCACAGCACCTACAACTGCGAGTACATCAAAGACAAGAAGTGCAAGTCTGGGCCTTGCCATCTGGATAATTCAGCCATGGGTCAGAGCCCCCTCTCTGCAGTCTGGTCTTTGCTGCTGCTGCTCTGGTTCCTCGTGGTGAGGGCCTTTCCAGATGGTCCAGGCCTCCTTTGA |
ORF Protein Sequence | MQMPAMMSLLLVSVGLMEALQAQSHPITRRDLFSQEIQLDMALASFDDQYAGCAAAMTAALPDLNHTEFQANQVYADSWTLASSQWQERQARWPEWSLSPTRPSPPPLGFRDEHGVALLAYTANSPLHKEFNAAVREAGRSRAHYLHHFSFKTLHFLLTEALQLLGSGQRPPRCHQVFRGVHGLRFRPAGPRATVRLGGFASASLKHVAAQQFGEDTFFGIWTCLGAPIKGYSFFPGEEEVLIPPFETFQVINASRLAQGPARIYLRALGKHSTYNCEYIKDKKCKSGPCHLDNSAMGQSPLSAVWSLLLLLWFLVVRAFPDGPGLL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0086-Ab | Anti-NAR1/ ART1/ ART2 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0086-Ag | ART1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001859 | Human ART1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001859 | Human ART1 Lentivirus particle |
Target information
Target ID | GM-MP0086 |
Target Name | ART1 |
Gene ID | 417, 11870, 718154, 308873, 101086418, 476821, 100052937 |
Gene Symbol and Synonyms | ADPRT,ART1,ART2,ARTC1,CD296,RT6,Yac-1 |
Uniprot Accession | P52961 |
Uniprot Entry Name | NAR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000129744 |
Target Classification | Not Available |
ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.