Human CACNG2/MRD10 ORF/cDNA clone-Lentivirus plasmid (NM_006078.4 )

Cat. No.: pGMLP001919
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CACNG2/MRD10 Lentiviral expression plasmid for CACNG2 lentivirus packaging, CACNG2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CACNG2/MRD10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $543
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001919
Gene Name CACNG2
Accession Number NM_006078.4
Gene ID 10369
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 972 bp
Gene Alias MRD10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCTGTTTGATCGAGGTGTTCAAATGCTTTTAACCACCGTTGGTGCTTTCGCTGCCTTCAGCCTGATGACCATAGCTGTGGGAACCGACTATTGGCTCTACTCCAGAGGGGTTTGCAAGACCAAAAGTGTCAGTGAGAATGAAACCAGCAAAAAGAACGAGGAAGTTATGACCCATTCCGGATTATGGAGAACCTGCTGCCTAGAAGGGAATTTCAAAGGTCTGTGCAAGCAAATTGATCACTTCCCAGAGGATGCAGATTACGAAGCTGACACAGCAGAATATTTCCTCCGGGCCGTGAGGGCCTCCAGCATTTTCCCAATCCTGAGTGTGATTCTGCTTTTCATGGGTGGCCTCTGCATCGCAGCCAGCGAGTTCTACAAAACTCGACACAACATCATCCTGAGTGCCGGCATCTTCTTCGTGTCTGCAGGTCTGAGTAACATCATTGGCATCATAGTGTACATATCTGCCAATGCCGGAGACCCCTCCAAGAGCGACTCCAAAAAGAATAGTTACTCATACGGCTGGTCCTTCTACTTCGGGGCCCTGTCCTTCATCATCGCCGAGATGGTCGGGGTGCTGGCGGTGCACATGTTTATCGACCGGCACAAACAGCTGCGGGCCACGGCCCGCGCCACGGACTACCTCCAGGCCTCTGCCATCACCCGCATCCCCAGCTACCGCTACCGCTACCAGCGCCGCAGCCGCTCCAGCTCGCGCTCCACGGAGCCCTCACACTCCAGGGACGCCTCCCCCGTGGGCATCAAGGGCTTCAACACCCTGCCGTCCACGGAGATCTCCATGTACACGCTCAGCAGGGACCCCCTGAAGGCCGCCACCACGCCCACCGCCACCTACAACTCCGACAGGGATAACAGCTTCCTCCAGGTTCACAACTGTATCCAGAAGGAGAACAAGGACTCTCTCCACTCCAACACAGCCAACCGCCGGACCACCCCCGTATAA
ORF Protein Sequence MGLFDRGVQMLLTTVGAFAAFSLMTIAVGTDYWLYSRGVCKTKSVSENETSKKNEEVMTHSGLWRTCCLEGNFKGLCKQIDHFPEDADYEADTAEYFLRAVRASSIFPILSVILLFMGGLCIAASEFYKTRHNIILSAGIFFVSAGLSNIIGIIVYISANAGDPSKSDSKKNSYSYGWSFYFGALSFIIAEMVGVLAVHMFIDRHKQLRATARATDYLQASAITRIPSYRYRYQRRSRSSSRSTEPSHSRDASPVGIKGFNTLPSTEISMYTLSRDPLKAATTPTATYNSDRDNSFLQVHNCIQKENKDSLHSNTANRRTTPV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0168-Ab Anti-CCG2/ CACNG2/ MRD10 monoclonal antibody
    Target Antigen GM-Tg-g-MP0168-Ag CACNG2 VLP (virus-like particle)
    ORF Viral Vector pGMLP001919 Human CACNG2 Lentivirus plasmid
    ORF Viral Vector vGMLP001919 Human CACNG2 Lentivirus particle


    Target information

    Target ID GM-MP0168
    Target Name CACNG2
    Gene ID 10369, 12300, 696294, 84347, 101094770, 481279, 286800, 100054570
    Gene Symbol and Synonyms B230105C07Rik,B930041E13Rik,CACNG2,Ipr328,MRD10,stargazer,stargazin,stg,wag,waggler
    Uniprot Accession Q9Y698
    Uniprot Entry Name CCG2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166862
    Target Classification Not Available

    The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. The AMPA subtype of ionotropic glutamate receptors are ligand gated ion channels that are typically activated by glutamate released from presynaptic neuron terminals and mediate fast neurotransmission in excitatory synapses. TARPs thus play an important role in synaptic plasticity, learning and memory. Mutations in this gene cause an autosomal dominant form of cognitive disability. [provided by RefSeq, Jul 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.