Human CACNG2/MRD10 ORF/cDNA clone-Lentivirus plasmid (NM_006078.4 )
Cat. No.: pGMLP001919
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CACNG2/MRD10 Lentiviral expression plasmid for CACNG2 lentivirus packaging, CACNG2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CACNG2/MRD10 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001919 |
Gene Name | CACNG2 |
Accession Number | NM_006078.4 |
Gene ID | 10369 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 972 bp |
Gene Alias | MRD10 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGGGCTGTTTGATCGAGGTGTTCAAATGCTTTTAACCACCGTTGGTGCTTTCGCTGCCTTCAGCCTGATGACCATAGCTGTGGGAACCGACTATTGGCTCTACTCCAGAGGGGTTTGCAAGACCAAAAGTGTCAGTGAGAATGAAACCAGCAAAAAGAACGAGGAAGTTATGACCCATTCCGGATTATGGAGAACCTGCTGCCTAGAAGGGAATTTCAAAGGTCTGTGCAAGCAAATTGATCACTTCCCAGAGGATGCAGATTACGAAGCTGACACAGCAGAATATTTCCTCCGGGCCGTGAGGGCCTCCAGCATTTTCCCAATCCTGAGTGTGATTCTGCTTTTCATGGGTGGCCTCTGCATCGCAGCCAGCGAGTTCTACAAAACTCGACACAACATCATCCTGAGTGCCGGCATCTTCTTCGTGTCTGCAGGTCTGAGTAACATCATTGGCATCATAGTGTACATATCTGCCAATGCCGGAGACCCCTCCAAGAGCGACTCCAAAAAGAATAGTTACTCATACGGCTGGTCCTTCTACTTCGGGGCCCTGTCCTTCATCATCGCCGAGATGGTCGGGGTGCTGGCGGTGCACATGTTTATCGACCGGCACAAACAGCTGCGGGCCACGGCCCGCGCCACGGACTACCTCCAGGCCTCTGCCATCACCCGCATCCCCAGCTACCGCTACCGCTACCAGCGCCGCAGCCGCTCCAGCTCGCGCTCCACGGAGCCCTCACACTCCAGGGACGCCTCCCCCGTGGGCATCAAGGGCTTCAACACCCTGCCGTCCACGGAGATCTCCATGTACACGCTCAGCAGGGACCCCCTGAAGGCCGCCACCACGCCCACCGCCACCTACAACTCCGACAGGGATAACAGCTTCCTCCAGGTTCACAACTGTATCCAGAAGGAGAACAAGGACTCTCTCCACTCCAACACAGCCAACCGCCGGACCACCCCCGTATAA |
ORF Protein Sequence | MGLFDRGVQMLLTTVGAFAAFSLMTIAVGTDYWLYSRGVCKTKSVSENETSKKNEEVMTHSGLWRTCCLEGNFKGLCKQIDHFPEDADYEADTAEYFLRAVRASSIFPILSVILLFMGGLCIAASEFYKTRHNIILSAGIFFVSAGLSNIIGIIVYISANAGDPSKSDSKKNSYSYGWSFYFGALSFIIAEMVGVLAVHMFIDRHKQLRATARATDYLQASAITRIPSYRYRYQRRSRSSSRSTEPSHSRDASPVGIKGFNTLPSTEISMYTLSRDPLKAATTPTATYNSDRDNSFLQVHNCIQKENKDSLHSNTANRRTTPV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0168-Ab | Anti-CCG2/ CACNG2/ MRD10 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0168-Ag | CACNG2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001919 | Human CACNG2 Lentivirus plasmid |
ORF Viral Vector | vGMLP001919 | Human CACNG2 Lentivirus particle |
Target information
Target ID | GM-MP0168 |
Target Name | CACNG2 |
Gene ID | 10369, 12300, 696294, 84347, 101094770, 481279, 286800, 100054570 |
Gene Symbol and Synonyms | B230105C07Rik,B930041E13Rik,CACNG2,Ipr328,MRD10,stargazer,stargazin,stg,wag,waggler |
Uniprot Accession | Q9Y698 |
Uniprot Entry Name | CCG2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000166862 |
Target Classification | Not Available |
The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. The AMPA subtype of ionotropic glutamate receptors are ligand gated ion channels that are typically activated by glutamate released from presynaptic neuron terminals and mediate fast neurotransmission in excitatory synapses. TARPs thus play an important role in synaptic plasticity, learning and memory. Mutations in this gene cause an autosomal dominant form of cognitive disability. [provided by RefSeq, Jul 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.