Human FKBP4/FKBP51/FKBP52 ORF/cDNA clone-Lentivirus plasmid (NM_002014.3 )

Cat. No.: pGMLP001939
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FKBP4/FKBP51/FKBP52 Lentiviral expression plasmid for FKBP4 lentivirus packaging, FKBP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to FKBP4/FKBP51 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $686.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001939
Gene Name FKBP4
Accession Number NM_002014.3
Gene ID 2288
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1380 bp
Gene Alias FKBP51,FKBP52,FKBP59,HBI,Hsp56,p52,PPIase
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACAGCCGAGGAGATGAAGGCGACCGAGAGCGGGGCGCAGTCGGCGCCGCTGCCCATGGAGGGAGTGGACATCAGCCCCAAACAGGACGAAGGCGTGCTGAAGGTCATCAAGAGAGAGGGCACAGGTACAGAGATGCCCATGATTGGGGACCGAGTCTTTGTCCACTACACTGGCTGGCTATTAGATGGCACAAAGTTTGACTCCAGTCTGGATCGCAAGGACAAATTCTCCTTTGACCTGGGAAAAGGGGAGGTCATCAAGGCTTGGGACATTGCCATAGCCACCATGAAGGTGGGGGAGGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAGCAGGCAGTCCTCCAAAGATTCCCCCCAATGCCACGCTTGTATTTGAGGTGGAGTTGTTTGAGTTTAAGGGAGAAGATCTGACGGAAGAGGAAGATGGCGGAATCATTCGCAGAATACAGACTCGCGGTGAAGGCTATGCTAAGCCCAATGAGGGTGCTATCGTGGAGGTTGCACTGGAAGGGTACTACAAGGACAAGCTCTTTGACCAGCGGGAGCTCCGCTTTGAGATTGGCGAGGGGGAGAACCTGGATCTGCCTTATGGTCTGGAGAGGGCCATTCAGCGCATGGAGAAAGGAGAACATTCCATCGTGTACCTCAAGCCCAGCTATGCTTTTGGCAGTGTTGGGAAGGAAAAGTTCCAAATCCCACCAAATGCTGAGCTGAAATATGAATTACACCTCAAGAGTTTTGAAAAGGCCAAGGAGTCTTGGGAGATGAATTCAGAAGAGAAGCTGGAACAGAGCACCATAGTGAAAGAGCGGGGCACTGTGTACTTCAAGGAAGGTAAATACAAGCAAGCTTTACTACAGTATAAGAAGATCGTGTCTTGGCTGGAATATGAGTCTAGTTTTTCCAATGAGGAAGCACAGAAAGCACAGGCCCTTCGACTGGCCTCTCACCTCAACCTGGCCATGTGTCATCTGAAACTACAGGCCTTCTCTGCTGCCATTGAAAGCTGTAACAAGGCCCTAGAACTGGACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCCGTGAATGACTTTGAACTGGCACGGGCTGATTTCCAGAAGGTCCTGCAGCTCTACCCCAACAACAAAGCCGCCAAGACCCAGCTGGCTGTGTGCCAGCAGCGGATCCGAAGGCAGCTTGCCCGGGAGAAGAAGCTCTATGCCAATATGTTTGAGAGGCTGGCTGAGGAGGAGAACAAGGCCAAGGCAGAGGCTTCCTCAGGAGACCATCCCACTGACACAGAGATGAAGGAGGAGCAGAAGAGCAACACGGCAGGGAGCCAGTCTCAGGTGGAGACAGAAGCATAG
ORF Protein Sequence MTAEEMKATESGAQSAPLPMEGVDISPKQDEGVLKVIKREGTGTEMPMIGDRVFVHYTGWLLDGTKFDSSLDRKDKFSFDLGKGEVIKAWDIAIATMKVGEVCHITCKPEYAYGSAGSPPKIPPNATLVFEVELFEFKGEDLTEEEDGGIIRRIQTRGEGYAKPNEGAIVEVALEGYYKDKLFDQRELRFEIGEGENLDLPYGLERAIQRMEKGEHSIVYLKPSYAFGSVGKEKFQIPPNAELKYELHLKSFEKAKESWEMNSEEKLEQSTIVKERGTVYFKEGKYKQALLQYKKIVSWLEYESSFSNEEAQKAQALRLASHLNLAMCHLKLQAFSAAIESCNKALELDSNNEKGLFRRGEAHLAVNDFELARADFQKVLQLYPNNKAAKTQLAVCQQRIRRQLAREKKLYANMFERLAEEENKAKAEASSGDHPTDTEMKEEQKSNTAGSQSQVETEA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T87020-Ab Anti-FKBP4 monoclonal antibody
    Target Antigen GM-Tg-g-T87020-Ag FKBP4 protein
    ORF Viral Vector pGMLP001939 Human FKBP4 Lentivirus plasmid
    ORF Viral Vector vGMLP001939 Human FKBP4 Lentivirus particle


    Target information

    Target ID GM-T87020
    Target Name FKBP4
    Gene ID 2288, 14228, 708481, 260321, 101098306, 477726, 508535, 100057420
    Gene Symbol and Synonyms FKBP-4,FKBP-52,FKBP4,FKBP51,FKBP52,FKBP59,FKPB52,HBI,Hsp56,p52,p59,PPIase
    Uniprot Accession Q02790
    Uniprot Entry Name FKBP4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000004478
    Target Classification Not Available

    The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.