Human FKBP4/FKBP51/FKBP52 ORF/cDNA clone-Lentivirus particle (NM_002014.3 )
Cat. No.: vGMLP001939
Pre-made Human FKBP4/FKBP51/FKBP52 Lentiviral expression plasmid for FKBP4 lentivirus packaging, FKBP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
FKBP4/FKBP51 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001939 | Human FKBP4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001939 |
| Gene Name | FKBP4 |
| Accession Number | NM_002014.3 |
| Gene ID | 2288 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1380 bp |
| Gene Alias | FKBP51,FKBP52,FKBP59,HBI,Hsp56,p52,PPIase |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGACAGCCGAGGAGATGAAGGCGACCGAGAGCGGGGCGCAGTCGGCGCCGCTGCCCATGGAGGGAGTGGACATCAGCCCCAAACAGGACGAAGGCGTGCTGAAGGTCATCAAGAGAGAGGGCACAGGTACAGAGATGCCCATGATTGGGGACCGAGTCTTTGTCCACTACACTGGCTGGCTATTAGATGGCACAAAGTTTGACTCCAGTCTGGATCGCAAGGACAAATTCTCCTTTGACCTGGGAAAAGGGGAGGTCATCAAGGCTTGGGACATTGCCATAGCCACCATGAAGGTGGGGGAGGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAGCAGGCAGTCCTCCAAAGATTCCCCCCAATGCCACGCTTGTATTTGAGGTGGAGTTGTTTGAGTTTAAGGGAGAAGATCTGACGGAAGAGGAAGATGGCGGAATCATTCGCAGAATACAGACTCGCGGTGAAGGCTATGCTAAGCCCAATGAGGGTGCTATCGTGGAGGTTGCACTGGAAGGGTACTACAAGGACAAGCTCTTTGACCAGCGGGAGCTCCGCTTTGAGATTGGCGAGGGGGAGAACCTGGATCTGCCTTATGGTCTGGAGAGGGCCATTCAGCGCATGGAGAAAGGAGAACATTCCATCGTGTACCTCAAGCCCAGCTATGCTTTTGGCAGTGTTGGGAAGGAAAAGTTCCAAATCCCACCAAATGCTGAGCTGAAATATGAATTACACCTCAAGAGTTTTGAAAAGGCCAAGGAGTCTTGGGAGATGAATTCAGAAGAGAAGCTGGAACAGAGCACCATAGTGAAAGAGCGGGGCACTGTGTACTTCAAGGAAGGTAAATACAAGCAAGCTTTACTACAGTATAAGAAGATCGTGTCTTGGCTGGAATATGAGTCTAGTTTTTCCAATGAGGAAGCACAGAAAGCACAGGCCCTTCGACTGGCCTCTCACCTCAACCTGGCCATGTGTCATCTGAAACTACAGGCCTTCTCTGCTGCCATTGAAAGCTGTAACAAGGCCCTAGAACTGGACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCCGTGAATGACTTTGAACTGGCACGGGCTGATTTCCAGAAGGTCCTGCAGCTCTACCCCAACAACAAAGCCGCCAAGACCCAGCTGGCTGTGTGCCAGCAGCGGATCCGAAGGCAGCTTGCCCGGGAGAAGAAGCTCTATGCCAATATGTTTGAGAGGCTGGCTGAGGAGGAGAACAAGGCCAAGGCAGAGGCTTCCTCAGGAGACCATCCCACTGACACAGAGATGAAGGAGGAGCAGAAGAGCAACACGGCAGGGAGCCAGTCTCAGGTGGAGACAGAAGCATAG |
| ORF Protein Sequence | MTAEEMKATESGAQSAPLPMEGVDISPKQDEGVLKVIKREGTGTEMPMIGDRVFVHYTGWLLDGTKFDSSLDRKDKFSFDLGKGEVIKAWDIAIATMKVGEVCHITCKPEYAYGSAGSPPKIPPNATLVFEVELFEFKGEDLTEEEDGGIIRRIQTRGEGYAKPNEGAIVEVALEGYYKDKLFDQRELRFEIGEGENLDLPYGLERAIQRMEKGEHSIVYLKPSYAFGSVGKEKFQIPPNAELKYELHLKSFEKAKESWEMNSEEKLEQSTIVKERGTVYFKEGKYKQALLQYKKIVSWLEYESSFSNEEAQKAQALRLASHLNLAMCHLKLQAFSAAIESCNKALELDSNNEKGLFRRGEAHLAVNDFELARADFQKVLQLYPNNKAAKTQLAVCQQRIRRQLAREKKLYANMFERLAEEENKAKAEASSGDHPTDTEMKEEQKSNTAGSQSQVETEA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T87020-Ab | Anti-FKBP4 monoclonal antibody |
| Target Antigen | GM-Tg-g-T87020-Ag | FKBP4 protein |
| ORF Viral Vector | pGMLP001939 | Human FKBP4 Lentivirus plasmid |
| ORF Viral Vector | vGMLP001939 | Human FKBP4 Lentivirus particle |
Target information
| Target ID | GM-T87020 |
| Target Name | FKBP4 |
| Gene ID | 2288, 14228, 708481, 260321, 101098306, 477726, 508535, 100057420 |
| Gene Symbol and Synonyms | FKBP-4,FKBP-52,FKBP4,FKBP51,FKBP52,FKBP59,FKPB52,HBI,Hsp56,p52,p59,PPIase |
| Uniprot Accession | Q02790 |
| Uniprot Entry Name | FKBP4_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000004478 |
| Target Classification | Not Available |
The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


