Human CCL21/6Ckine/ CKb9 ORF/cDNA clone-Lentivirus plasmid (NM_002989)
Pre-made Human CCL21/6Ckine/ CKb9 Lentiviral expression plasmid for CCL21 lentivirus packaging, CCL21 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCL21/6Ckine products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002050 | Human CCL21 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002050 |
Gene Name | CCL21 |
Accession Number | NM_002989 |
Gene ID | 6366 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 405 bp |
Gene Alias | 6Ckine, CKb9, ECL, SCYA21, SLC, TCA4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTCAGTCACTGGCTCTGAGCCTCCTTATCCTGGTTCTGGCCTTTGGCATCCCCAGGACCCAAGGCAGTGATGGAGGGGCTCAGGACTGTTGCCTCAAGTACAGCCAAAGGAAGATTCCCGCCAAGGTTGTCCGCAGCTACCGGAAGCAGGAACCAAGCTTAGGCTGCTCCATCCCAGCTATCCTGTTCTTGCCCCGCAAGCGCTCTCAGGCAGAGCTATGTGCAGACCCAAAGGAGCTCTGGGTGCAGCAGCTGATGCAGCATCTGGACAAGACACCATCCCCACAGAAACCAGCCCAGGGCTGCAGGAAGGACAGGGGGGCCTCCAAGACTGGCAAGAAAGGAAAGGGCTCCAAAGGCTGCAAGAGGACTGAGCGGTCACAGACCCCTAAAGGGCCATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T93237-Ab | Anti-CCL21/ 6Ckine/ CKb9 functional antibody |
Target Antigen | GM-Tg-g-T93237-Ag | CCL21 protein |
Cytokine | cks-Tg-g-GM-T93237 | chemokine (C-C motif) ligand 21 (CCL21) protein & antibody |
ORF Viral Vector | pGMLP002050 | Human CCL21 Lentivirus plasmid |
ORF Viral Vector | vGMLP002050 | Human CCL21 Lentivirus particle |
ORF Viral Vector | pGMLV002159 | Mouse Ccl21a Lentivirus plasmid |
Target information
Target ID | GM-T93237 |
Target Name | CCL21 |
Gene ID | 6366, 18829, 574183, 298006, 101087275, 448796, 511112 |
Gene Symbol and Synonyms | 6CKBAC2,6Ckine,ALP,CCL21,Ccl21a,Ccl21b,CKb9,ECL,Gm1987,plt,SCYA21,SCYA21a,Scya21b,SLC,TCA4 |
Uniprot Accession | O00585 |
Uniprot Entry Name | CCL21_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | ovarian cancer |
Gene Ensembl | ENSG00000137077 |
Target Classification | Not Available |
This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.