Human CCL21/6Ckine/ CKb9 ORF/cDNA clone-Lentivirus plasmid (NM_002989)

Pre-made Human CCL21/6Ckine/ CKb9 Lentiviral expression plasmid for CCL21 lentivirus packaging, CCL21 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CCL21/6Ckine products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002050 Human CCL21 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002050
Gene Name CCL21
Accession Number NM_002989
Gene ID 6366
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 405 bp
Gene Alias 6Ckine, CKb9, ECL, SCYA21, SLC, TCA4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTCAGTCACTGGCTCTGAGCCTCCTTATCCTGGTTCTGGCCTTTGGCATCCCCAGGACCCAAGGCAGTGATGGAGGGGCTCAGGACTGTTGCCTCAAGTACAGCCAAAGGAAGATTCCCGCCAAGGTTGTCCGCAGCTACCGGAAGCAGGAACCAAGCTTAGGCTGCTCCATCCCAGCTATCCTGTTCTTGCCCCGCAAGCGCTCTCAGGCAGAGCTATGTGCAGACCCAAAGGAGCTCTGGGTGCAGCAGCTGATGCAGCATCTGGACAAGACACCATCCCCACAGAAACCAGCCCAGGGCTGCAGGAAGGACAGGGGGGCCTCCAAGACTGGCAAGAAAGGAAAGGGCTCCAAAGGCTGCAAGAGGACTGAGCGGTCACAGACCCCTAAAGGGCCATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T93237-Ab Anti-CCL21/ 6Ckine/ CKb9 functional antibody
    Target Antigen GM-Tg-g-T93237-Ag CCL21 protein
    Cytokine cks-Tg-g-GM-T93237 chemokine (C-C motif) ligand 21 (CCL21) protein & antibody
    ORF Viral Vector pGMLP002050 Human CCL21 Lentivirus plasmid
    ORF Viral Vector vGMLP002050 Human CCL21 Lentivirus particle
    ORF Viral Vector pGMLV002159 Mouse Ccl21a Lentivirus plasmid


    Target information

    Target ID GM-T93237
    Target Name CCL21
    Gene ID 6366, 18829, 574183, 298006, 101087275, 448796, 511112
    Gene Symbol and Synonyms 6CKBAC2,6Ckine,ALP,CCL21,Ccl21a,Ccl21b,CKb9,ECL,Gm1987,plt,SCYA21,SCYA21a,Scya21b,SLC,TCA4
    Uniprot Accession O00585
    Uniprot Entry Name CCL21_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease ovarian cancer
    Gene Ensembl ENSG00000137077
    Target Classification Not Available

    This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.