Human DPYD/DHP/ DHPDHASE ORF/cDNA clone-Lentivirus plasmid (NM_001160301)
Pre-made Human DPYD/DHP/ DHPDHASE Lentiviral expression plasmid for DPYD lentivirus packaging, DPYD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to DPYD/DHP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002087 | Human DPYD Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002087 |
Gene Name | DPYD |
Accession Number | NM_001160301 |
Gene ID | 1806 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 522 bp |
Gene Alias | DHP, DHPDHASE, DPD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCCTGTGCTCAGTAAGGACTCGGCGGACATCGAGAGTATCCTGGCTTTAAATCCTCGAACACAAACTCATGCAACTCTGTGTTCCACTTCGGCCAAGAAATTAGACAAGAAACATTGGAAAAGAAATCCTGATAAGAACTGCTTTAATTGTGAGAAGCTGGAGAATAATTTTGATGACATCAAGCACACGACTCTTGGTGAGCGAGGAGCTCTCCGAGAAGCAATGAGATGCCTGAAATGTGCAGATGCCCCGTGTCAGAAGAGCTGTCCAACTAATCTTGATATTAAATCATTCATCACAAGTATTGCAAACAAGAACTATTATGGAGCTGCTAAGATGATATTTTCTGACAACCCACTTGGTCTGACTTGTGGAATGGTATGTCCAACCTCTGATCTTTGTGTAGGTGGATGCAATTTATATGCCACTGAAGAGGGACCCATTAATATTGGTGGATTGCAGCAATTTGCTACTGAGACTTTGATCCTGGCTTTCTCTTTAATGAATCATTTGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T75890-Ab | Anti-DPYD monoclonal antibody |
Target Antigen | GM-Tg-g-T75890-Ag | DPYD protein |
ORF Viral Vector | pGMLV001495 | Human DPYD Lentivirus plasmid |
ORF Viral Vector | pGMLP002087 | Human DPYD Lentivirus plasmid |
ORF Viral Vector | vGMLV001495 | Human DPYD Lentivirus particle |
ORF Viral Vector | vGMLP002087 | Human DPYD Lentivirus particle |
Target information
Target ID | GM-T75890 |
Target Name | DPYD |
Gene ID | 1806, 99586, 715672, 81656, 101084380, 479935, 281124, 100057177 |
Gene Symbol and Synonyms | DHP,DHPDHASE,DPD,DPYD,DYPD,E330028L06Rik |
Uniprot Accession | Q12882 |
Uniprot Entry Name | DPYD_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000188641 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.