Human FABP1/FABPL/ L-FABP ORF/cDNA clone-Lentivirus plasmid (NM_001443)
Pre-made Human FABP1/FABPL/ L-FABP Lentiviral expression plasmid for FABP1 lentivirus packaging, FABP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to FABP1/FABPL products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002096 | Human FABP1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002096 |
Gene Name | FABP1 |
Accession Number | NM_001443 |
Gene ID | 2168 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 384 bp |
Gene Alias | FABPL, L-FABP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGTTTCTCCGGCAAGTACCAACTGCAGAGCCAGGAAAACTTTGAAGCCTTCATGAAGGCAATCGGTCTGCCGGAAGAGCTCATCCAGAAGGGGAAGGATATCAAGGGGGTGTCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTCACCATCACCGCTGGGTCCAAAGTGATCCAAAACGAATTCACGGTGGGGGAGGAATGTGAGCTGGAGACAATGACAGGGGAGAAAGTCAAGACAGTGGTTCAGTTGGAAGGTGACAATAAACTGGTGACAACTTTCAAAAACATCAAGTCTGTGACCGAACTCAACGGCGACATAATCACCAATACCATGACATTGGGTGACATTGTCTTCAAGAGAATCAGCAAGAGAATTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T73712-Ab | Anti-FABP1 monoclonal antibody |
Target Antigen | GM-Tg-g-T73712-Ag | FABP1 protein |
ORF Viral Vector | pGMLP002096 | Human FABP1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002096 | Human FABP1 Lentivirus particle |
Target information
Target ID | GM-T73712 |
Target Name | FABP1 |
Gene ID | 2168, 14080, 699776, 24360, 101095488, 403619, 327700, 100052746 |
Gene Symbol and Synonyms | FABP,FABP1,FABPL,Fabplg,L-FABP,p14,SCP,SCP. |
Uniprot Accession | P07148 |
Uniprot Entry Name | FABPL_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Injury to Kidney, Acute kidney failure, Chronic Kidney Disease, Chronic nephritic syndrome, Complications of kidney transplant, Contrast - Induced Nephropathy, Coronary artery disease, Delayed Graft Function, Other diseases of intestines (K55-K64), Other obstructive and reflux uropathy, Tubulo-interstitial nephropathy in systemic lupus erythematosus, Type 1 diabetes mellitus, Type 2 diabetes mellitus with diabetic chronic kidney disease, Type 2 diabetes mellitus with diabetic nephropathy, Diabetes mellitus |
Gene Ensembl | ENSG00000163586 |
Target Classification | Not Available |
This gene encodes the fatty acid binding protein found in liver. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. This protein and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Mar 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.