Human FABP1/FABPL/ L-FABP ORF/cDNA clone-Lentivirus plasmid (NM_001443)

Pre-made Human FABP1/FABPL/ L-FABP Lentiviral expression plasmid for FABP1 lentivirus packaging, FABP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FABP1/FABPL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002096 Human FABP1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002096
Gene Name FABP1
Accession Number NM_001443
Gene ID 2168
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 384 bp
Gene Alias FABPL, L-FABP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGTTTCTCCGGCAAGTACCAACTGCAGAGCCAGGAAAACTTTGAAGCCTTCATGAAGGCAATCGGTCTGCCGGAAGAGCTCATCCAGAAGGGGAAGGATATCAAGGGGGTGTCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTCACCATCACCGCTGGGTCCAAAGTGATCCAAAACGAATTCACGGTGGGGGAGGAATGTGAGCTGGAGACAATGACAGGGGAGAAAGTCAAGACAGTGGTTCAGTTGGAAGGTGACAATAAACTGGTGACAACTTTCAAAAACATCAAGTCTGTGACCGAACTCAACGGCGACATAATCACCAATACCATGACATTGGGTGACATTGTCTTCAAGAGAATCAGCAAGAGAATTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T73712-Ab Anti-FABP1 monoclonal antibody
    Target Antigen GM-Tg-g-T73712-Ag FABP1 protein
    ORF Viral Vector pGMLP002096 Human FABP1 Lentivirus plasmid
    ORF Viral Vector vGMLP002096 Human FABP1 Lentivirus particle


    Target information

    Target ID GM-T73712
    Target Name FABP1
    Gene ID 2168, 14080, 699776, 24360, 101095488, 403619, 327700, 100052746
    Gene Symbol and Synonyms FABP,FABP1,FABPL,Fabplg,L-FABP,p14,SCP,SCP.
    Uniprot Accession P07148
    Uniprot Entry Name FABPL_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Injury to Kidney, Acute kidney failure, Chronic Kidney Disease, Chronic nephritic syndrome, Complications of kidney transplant, Contrast - Induced Nephropathy, Coronary artery disease, Delayed Graft Function, Other diseases of intestines (K55-K64), Other obstructive and reflux uropathy, Tubulo-interstitial nephropathy in systemic lupus erythematosus, Type 1 diabetes mellitus, Type 2 diabetes mellitus with diabetic chronic kidney disease, Type 2 diabetes mellitus with diabetic nephropathy, Diabetes mellitus
    Gene Ensembl ENSG00000163586
    Target Classification Not Available

    This gene encodes the fatty acid binding protein found in liver. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. This protein and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Mar 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.