Human MLEC/KIAA0152 ORF/cDNA clone-Lentivirus plasmid (NM_014730)

Cat. No.: pGMLP002141
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MLEC/KIAA0152 Lentiviral expression plasmid for MLEC lentivirus packaging, MLEC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MLEC/KIAA0152 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $519.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002141
Gene Name MLEC
Accession Number NM_014730
Gene ID 9761
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 879 bp
Gene Alias KIAA0152
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGGAGCCTGGGCGGTTGAGGGAACCGCTGTGGCGCTCCTGCGACTGCTGCTGCTGCTGCTGCCGCCGGCGATCCGGGGACCCGGGCTCGGCGTGGCCGGCGTGGCCGGCGCGGCGGGGGCCGGGCTGCCCGAGAGCGTCATTTGGGCGGTCAACGCGGGTGGAGAGGCGCATGTGGACGTGCACGGGATCCACTTCCGCAAGGACCCTTTGGAAGGCCGGGTGGGCCGAGCCTCAGACTATGGCATGAAACTGCCAATCCTGCGTTCCAACCCTGAGGACCAGATCCTGTATCAAACTGAGCGGTACAATGAGGAGACCTTTGGCTACGAAGTGCCCATCAAAGAGGAGGGGGACTACGTGCTGGTCTTGAAATTTGCAGAGGTCTACTTTGCACAGTCCCAGCAAAAGGTATTTGATGTACGATTGAATGGCCACGTCGTGGTGAAGGACTTGGATATCTTTGATCGTGTTGGGCATAGCACAGCTCACGATGAAATTATACCTATGAGCATCAGAAAGGGGAAGCTGAGTGTCCAGGGGGAGGTGTCCACCTTCACAGGGAAACTCTACATTGAGTTTGTCAAGGGGTACTATGACAATCCCAAGGTCTGTGCACTCTACATCATGGCTGGGACAGTGGATGATGTACCAAAGCTTCAGCCTCATCCGGGATTGGAGAAGAAAGAAGAGGAAGAAGAAGAAGAAGAATATGATGAAGGGTCTAATCTCAAAAAACAGACCAATAAGAACCGGGTGCAGTCAGGCCCCCGCACACCCAACCCCTATGCCTCGGACAACAGCAGCCTCATGTTTCCCATCCTGGTGGCCTTCGGAGTCTTCATTCCAACCCTCTTCTGCCTCTGCCGGTTGTGA
ORF Protein Sequence MLGAWAVEGTAVALLRLLLLLLPPAIRGPGLGVAGVAGAAGAGLPESVIWAVNAGGEAHVDVHGIHFRKDPLEGRVGRASDYGMKLPILRSNPEDQILYQTERYNEETFGYEVPIKEEGDYVLVLKFAEVYFAQSQQKVFDVRLNGHVVVKDLDIFDRVGHSTAHDEIIPMSIRKGKLSVQGEVSTFTGKLYIEFVKGYYDNPKVCALYIMAGTVDDVPKLQPHPGLEKKEEEEEEEEYDEGSNLKKQTNKNRVQSGPRTPNPYASDNSSLMFPILVAFGVFIPTLFCLCRL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0817-Ab Anti-MLEC/ KIAA0152 monoclonal antibody
    Target Antigen GM-Tg-g-MP0817-Ag MLEC VLP (virus-like particle)
    ORF Viral Vector pGMLP002141 Human MLEC Lentivirus plasmid
    ORF Viral Vector vGMLP002141 Human MLEC Lentivirus particle


    Target information

    Target ID GM-MP0817
    Target Name MLEC
    Gene ID 9761, 109154, 697934, 304543, 101097425, 609274, 515309, 100050056
    Gene Symbol and Synonyms 2410014A08Rik,ESTM19,KIAA0152,mKIAA0152,MLEC,RGD1307736
    Uniprot Accession Q14165
    Uniprot Entry Name MLEC_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000110917
    Target Classification Not Available

    This gene encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic reticulum. This protein has also been shown to interact with ribophorin I and may be involved in the directing the degradation of misfolded proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.