Human MLEC/KIAA0152 ORF/cDNA clone-Lentivirus plasmid (NM_014730)
Cat. No.: pGMLP002141
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MLEC/KIAA0152 Lentiviral expression plasmid for MLEC lentivirus packaging, MLEC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
MLEC/KIAA0152 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002141 |
Gene Name | MLEC |
Accession Number | NM_014730 |
Gene ID | 9761 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 879 bp |
Gene Alias | KIAA0152 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGGGAGCCTGGGCGGTTGAGGGAACCGCTGTGGCGCTCCTGCGACTGCTGCTGCTGCTGCTGCCGCCGGCGATCCGGGGACCCGGGCTCGGCGTGGCCGGCGTGGCCGGCGCGGCGGGGGCCGGGCTGCCCGAGAGCGTCATTTGGGCGGTCAACGCGGGTGGAGAGGCGCATGTGGACGTGCACGGGATCCACTTCCGCAAGGACCCTTTGGAAGGCCGGGTGGGCCGAGCCTCAGACTATGGCATGAAACTGCCAATCCTGCGTTCCAACCCTGAGGACCAGATCCTGTATCAAACTGAGCGGTACAATGAGGAGACCTTTGGCTACGAAGTGCCCATCAAAGAGGAGGGGGACTACGTGCTGGTCTTGAAATTTGCAGAGGTCTACTTTGCACAGTCCCAGCAAAAGGTATTTGATGTACGATTGAATGGCCACGTCGTGGTGAAGGACTTGGATATCTTTGATCGTGTTGGGCATAGCACAGCTCACGATGAAATTATACCTATGAGCATCAGAAAGGGGAAGCTGAGTGTCCAGGGGGAGGTGTCCACCTTCACAGGGAAACTCTACATTGAGTTTGTCAAGGGGTACTATGACAATCCCAAGGTCTGTGCACTCTACATCATGGCTGGGACAGTGGATGATGTACCAAAGCTTCAGCCTCATCCGGGATTGGAGAAGAAAGAAGAGGAAGAAGAAGAAGAAGAATATGATGAAGGGTCTAATCTCAAAAAACAGACCAATAAGAACCGGGTGCAGTCAGGCCCCCGCACACCCAACCCCTATGCCTCGGACAACAGCAGCCTCATGTTTCCCATCCTGGTGGCCTTCGGAGTCTTCATTCCAACCCTCTTCTGCCTCTGCCGGTTGTGA |
ORF Protein Sequence | MLGAWAVEGTAVALLRLLLLLLPPAIRGPGLGVAGVAGAAGAGLPESVIWAVNAGGEAHVDVHGIHFRKDPLEGRVGRASDYGMKLPILRSNPEDQILYQTERYNEETFGYEVPIKEEGDYVLVLKFAEVYFAQSQQKVFDVRLNGHVVVKDLDIFDRVGHSTAHDEIIPMSIRKGKLSVQGEVSTFTGKLYIEFVKGYYDNPKVCALYIMAGTVDDVPKLQPHPGLEKKEEEEEEEEYDEGSNLKKQTNKNRVQSGPRTPNPYASDNSSLMFPILVAFGVFIPTLFCLCRL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0817-Ab | Anti-MLEC/ KIAA0152 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0817-Ag | MLEC VLP (virus-like particle) |
ORF Viral Vector | pGMLP002141 | Human MLEC Lentivirus plasmid |
ORF Viral Vector | vGMLP002141 | Human MLEC Lentivirus particle |
Target information
Target ID | GM-MP0817 |
Target Name | MLEC |
Gene ID | 9761, 109154, 697934, 304543, 101097425, 609274, 515309, 100050056 |
Gene Symbol and Synonyms | 2410014A08Rik,ESTM19,KIAA0152,mKIAA0152,MLEC,RGD1307736 |
Uniprot Accession | Q14165 |
Uniprot Entry Name | MLEC_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000110917 |
Target Classification | Not Available |
This gene encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic reticulum. This protein has also been shown to interact with ribophorin I and may be involved in the directing the degradation of misfolded proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.