Human CD200R1/CD200R/HCRTR2 ORF/cDNA clone-Lentivirus plasmid (NM_138806)

Cat. No.: pGMLP002275
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD200R1/CD200R/HCRTR2 Lentiviral expression plasmid for CD200R1 lentivirus packaging, CD200R1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD200R1/CD200R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $593.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002275
Gene Name CD200R1
Accession Number NM_138806
Gene ID 131450
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1047 bp
Gene Alias CD200R,HCRTR2,MOX2R,OX2R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCTGCCCTTGGAGAACTGCTAACCTAGGGCTACTGTTGATTTTGACTATCTTCTTAGTGGCCGAAGCGGAGGGTGCTGCTCAACCAAACAACTCATTAATGCTGCAAACTAGCAAGGAGAATCATGCTTTAGCTTCAAGCAGTTTATGTATGGATGAAAAACAGATTACACAGAACTACTCGAAAGTACTCGCAGAAGTTAACACTTCATGGCCTGTAAAGATGGCTACAAATGCTGTGCTTTGTTGCCCTCCTATCGCATTAAGAAATTTGATCATAATAACATGGGAAATAATCCTGAGAGGCCAGCCTTCCTGCACAAAAGCCTACAAGAAAGAAACAAATGAGACCAAGGAAACCAACTGTACTGATGAGAGAATAACCTGGGTCTCCAGACCTGATCAGAATTCGGACCTTCAGATTCGTACCGTGGCCATCACTCATGACGGGTATTACAGATGCATAATGGTAACACCTGATGGGAATTTCCATCGTGGATATCACCTCCAAGTGTTAGTTACACCTGAAGTGACCCTGTTTCAAAACAGGAATAGAACTGCAGTATGCAAGGCAGTTGCAGGGAAGCCAGCTGCGCATATCTCCTGGATCCCAGAGGGCGATTGTGCCACTAAGCAAGAATACTGGAGCAATGGCACAGTGACTGTTAAGAGTACATGCCACTGGGAGGTCCACAATGTGTCTACCGTGACCTGCCACGTCTCCCATTTGACTGGCAACAAGAGTCTGTACATAGAGCTACTTCCTGTTCCAGGTGCCAAAAAATCAGCAAAATTATATATTCCATATATCATCCTTACTATTATTATTTTGACCATCGTGGGATTCATTTGGTTGTTGAAAGTCAATGGCTGCAGAAAATATAAATTGAATAAAACAGAATCTACTCCAGTTGTTGAGGAGGATGAAATGCAGCCCTATGCCAGCTACACAGAGAAGAACAATCCTCTCTATGATACTACAAACAAGGTGAAGGCATCTGAGGCATTACAAAGTGAAGTTGACACAGACCTCCATACTTTATAA
ORF Protein Sequence MLCPWRTANLGLLLILTIFLVAEAEGAAQPNNSLMLQTSKENHALASSSLCMDEKQITQNYSKVLAEVNTSWPVKMATNAVLCCPPIALRNLIIITWEIILRGQPSCTKAYKKETNETKETNCTDERITWVSRPDQNSDLQIRTVAITHDGYYRCIMVTPDGNFHRGYHLQVLVTPEVTLFQNRNRTAVCKAVAGKPAAHISWIPEGDCATKQEYWSNGTVTVKSTCHWEVHNVSTVTCHVSHLTGNKSLYIELLPVPGAKKSAKLYIPYIILTIIILTIVGFIWLLKVNGCRKYKLNKTESTPVVEEDEMQPYASYTEKNNPLYDTTNKVKASEALQSEVDTDLHTL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IO018-Ab Anti-MO2R1/ CD200R1/ CD200R monoclonal antibody
    Target Antigen GM-Tg-g-IO018-Ag CD200R1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002275 Human CD200R1 Lentivirus plasmid
    ORF Viral Vector vGMLP002275 Human CD200R1 Lentivirus particle


    Target information

    Target ID GM-IO018
    Target Name CD200R1
    Gene ID 131450, 57781, 708734, 100071456
    Gene Symbol and Synonyms CD200R,CD200R1,HCRTR2,MOX2R,OX2R
    Uniprot Accession Q8TD46
    Uniprot Entry Name MO2R1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000163606
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.