Human GSTA1/GST-epsilon/GST2 ORF/cDNA clone-Lentivirus plasmid (NM_145740)

Cat. No.: pGMLP002281
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GSTA1/GST-epsilon/GST2 Lentiviral expression plasmid for GSTA1 lentivirus packaging, GSTA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GSTA1/GST-epsilon products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $467.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002281
Gene Name GSTA1
Accession Number NM_145740
Gene ID 2938
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 669 bp
Gene Alias GST-epsilon,GST2,GSTA1-1,GTH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGAGAAGCCCAAGCTCCACTACTTCAATGCACGGGGCAGAATGGAGTCCACCCGGTGGCTCCTGGCTGCAGCTGGAGTAGAGTTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAGCTGGTGCAGACCAGAGCCATTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAAGACATAAAGGAGAGAGCCCTGATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAAATGATCCTCCTTCTGCCCGTATGTCCACCTGAGGAAAAAGATGCCAAGCTTGCCTTGATCAAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCATGGACAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCATCTGGTGGAACTTCTCTACTACGTCGAGGAGCTTGACTCCAGTCTTATCTCCAGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGGAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCAAGGAAGATTTTCAGGTTTTAA
ORF Protein Sequence MAEKPKLHYFNARGRMESTRWLLAAAGVEFEEKFIKSAEDLDKLRNDGYLMFQQVPMVEIDGMKLVQTRAILNYIASKYNLYGKDIKERALIDMYIEGIADLGEMILLLPVCPPEEKDAKLALIKEKIKNRYFPAFEKVLKSHGQDYLVGNKLSRADIHLVELLYYVEELDSSLISSFPLLKALKTRISNLPTVKKFLQPGSPRKPPMDEKSLEEARKIFRF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T17221-Ab Anti-GSTA1 monoclonal antibody
    Target Antigen GM-Tg-g-T17221-Ag GSTA1 protein
    ORF Viral Vector pGMLP001199 Human GSTA1 Lentivirus plasmid
    ORF Viral Vector pGMLP002281 Human GSTA1 Lentivirus plasmid
    ORF Viral Vector vGMLP001199 Human GSTA1 Lentivirus particle
    ORF Viral Vector vGMLP002281 Human GSTA1 Lentivirus particle


    Target information

    Target ID GM-T17221
    Target Name GSTA1
    Gene ID 2938, 777644
    Gene Symbol and Synonyms GST-epsilon,GST2,GSTA1,GSTA1-1,GTH1
    Uniprot Accession P08263
    Uniprot Entry Name GSTA1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000243955
    Target Classification Not Available

    This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.