Human GSTA1/GST-epsilon/GST2 ORF/cDNA clone-Lentivirus particle (NM_145740)
Cat. No.: vGMLP002281
Pre-made Human GSTA1/GST-epsilon/GST2 Lentiviral expression plasmid for GSTA1 lentivirus packaging, GSTA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
GSTA1/GST-epsilon products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002281 | Human GSTA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002281 |
Gene Name | GSTA1 |
Accession Number | NM_145740 |
Gene ID | 2938 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 669 bp |
Gene Alias | GST-epsilon,GST2,GSTA1-1,GTH1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCAGAGAAGCCCAAGCTCCACTACTTCAATGCACGGGGCAGAATGGAGTCCACCCGGTGGCTCCTGGCTGCAGCTGGAGTAGAGTTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAGCTGGTGCAGACCAGAGCCATTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAAGACATAAAGGAGAGAGCCCTGATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAAATGATCCTCCTTCTGCCCGTATGTCCACCTGAGGAAAAAGATGCCAAGCTTGCCTTGATCAAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCATGGACAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCATCTGGTGGAACTTCTCTACTACGTCGAGGAGCTTGACTCCAGTCTTATCTCCAGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGGAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCAAGGAAGATTTTCAGGTTTTAA |
ORF Protein Sequence | MAEKPKLHYFNARGRMESTRWLLAAAGVEFEEKFIKSAEDLDKLRNDGYLMFQQVPMVEIDGMKLVQTRAILNYIASKYNLYGKDIKERALIDMYIEGIADLGEMILLLPVCPPEEKDAKLALIKEKIKNRYFPAFEKVLKSHGQDYLVGNKLSRADIHLVELLYYVEELDSSLISSFPLLKALKTRISNLPTVKKFLQPGSPRKPPMDEKSLEEARKIFRF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T17221-Ab | Anti-GSTA1 monoclonal antibody |
Target Antigen | GM-Tg-g-T17221-Ag | GSTA1 protein |
ORF Viral Vector | pGMLP001199 | Human GSTA1 Lentivirus plasmid |
ORF Viral Vector | pGMLP002281 | Human GSTA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001199 | Human GSTA1 Lentivirus particle |
ORF Viral Vector | vGMLP002281 | Human GSTA1 Lentivirus particle |
Target information
Target ID | GM-T17221 |
Target Name | GSTA1 |
Gene ID | 2938, 777644 |
Gene Symbol and Synonyms | GST-epsilon,GST2,GSTA1,GSTA1-1,GTH1 |
Uniprot Accession | P08263 |
Uniprot Entry Name | GSTA1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000243955 |
Target Classification | Not Available |
This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.