Human ABHD12/ABHD12A/BEM46L2 ORF/cDNA clone-Lentivirus plasmid (NM_015600)

Cat. No.: pGMLP002291
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ABHD12/ABHD12A/BEM46L2 Lentiviral expression plasmid for ABHD12 lentivirus packaging, ABHD12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ABHD12/ABHD12A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $640.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002291
Gene Name ABHD12
Accession Number NM_015600
Gene ID 26090
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1215 bp
Gene Alias ABHD12A,BEM46L2,C20orf22,dJ965G21.2,PHARC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCGCTGCGCCGCCGCGGGCTCGTCCTCCTCCGGCTCGGCCGCCGCGGCGCTGGACGCCGACTGCCGCCTGAAGCAGAACCTACGCCTGACGGGCCCGGCGGCGGCTGAGCCGCGCTGCGCAGCCGACGCGGGAATGAAGCGGGCGCTGGGCAGGCGAAAGGGCGTGTGGTTGCGCCTGAGGAAGATACTTTTCTGTGTTTTGGGGTTGTACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGAATACAGGCCAAACTGATTTTCTTGAATTTCGTAAGAGTTCCCTATTTCATTGATTTGAAAAAACCACAGGATCAAGGTTTGAATCACACGTGTAACTACTACCTGCAGCCAGAGGAAGACGTGACCATTGGAGTCTGGCACACCGTCCCTGCAGTCTGGTGGAAGAACGCCCAAGGCAAAGACCAGATGTGGTATGAGGATGCCTTGGCTTCCAGCCACCCTATCATTCTGTACCTGCATGGGAACGCAGGTACCAGAGGAGGCGACCACCGCGTGGAGCTTTACAAGGTGCTGAGTTCCCTTGGTTACCATGTGGTCACCTTTGACTACAGAGGTTGGGGTGACTCAGTGGGAACGCCATCTGAGCGGGGCATGACCTATGACGCACTCCACGTTTTTGACTGGATCAAAGCAAGAAGTGGTGACAACCCCGTGTACATCTGGGGCCACTCTCTGGGCACTGGCGTGGCGACAAATCTGGTGCGGCGCCTCTGTGAGCGAGAGACGCCTCCAGATGCCCTTATATTGGAATCTCCATTCACTAATATCCGCGAAGAAGCTAAGAGCCATCCATTTTCAGTGATATATCGATACTTCCCTGGGTTTGACTGGTTCTTCCTTGATCCTATTACAAGTAGTGGAATTAAATTTGCAAATGATGAAAACGTGAAGCACATCTCCTGTCCCCTGCTCATCCTGCACGCTGAGGACGACCCGGTGGTGCCCTTCCAGCTTGGCAGAAAGCTCTATAGCATCGCCGCACCAGCTCGAAGCTTCCGAGATTTCAAAGTTCAGTTTGTGCCCTTTCATTCAGACCTTGGCTACAGGCACAAATACATTTACAAGAGCCCTGAGCTGCCACGGATACTGAGACCTCAGCAGGGCCCAGGTTCCAGCCCAGATCCCAGCATGTGGTCAGAGCTGGTGTGA
ORF Protein Sequence MRKRTEPVALEHERCAAAGSSSSGSAAAALDADCRLKQNLRLTGPAAAEPRCAADAGMKRALGRRKGVWLRLRKILFCVLGLYIAIPFLIKLCPGIQAKLIFLNFVRVPYFIDLKKPQDQGLNHTCNYYLQPEEDVTIGVWHTVPAVWWKNAQGKDQMWYEDALASSHPIILYLHGNAGTRGGDHRVELYKVLSSLGYHVVTFDYRGWGDSVGTPSERGMTYDALHVFDWIKARSGDNPVYIWGHSLGTGVATNLVRRLCERETPPDALILESPFTNIREEAKSHPFSVIYRYFPGFDWFFLDPITSSGIKFANDENVKHISCPLLILHAEDDPVVPFQLGRKLYSIAAPARSFRDFKVQFVPFHSDLGYRHKYIYKSPELPRILRPQQGPGSSPDPSMWSELV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0017-Ab Anti-ABD12/ ABHD12/ ABHD12A monoclonal antibody
    Target Antigen GM-Tg-g-MP0017-Ag ABHD12 VLP (virus-like particle)
    ORF Viral Vector pGMLP002291 Human ABHD12 Lentivirus plasmid
    ORF Viral Vector vGMLP002291 Human ABHD12 Lentivirus particle


    Target information

    Target ID GM-MP0017
    Target Name ABHD12
    Gene ID 26090, 76192, 705915, 499913, 101091357, 477004, 768242, 100057168
    Gene Symbol and Synonyms 1500011G07Rik,6330583M11Rik,ABHD12,ABHD12A,BEM46L2,C20orf22,dJ965G21.2,hABHD12,PHARC
    Uniprot Accession Q8N2K0
    Uniprot Entry Name ABD12_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000100997
    Target Classification Not Available

    This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.