Human IL22/IL-21/ IL-22 ORF/cDNA clone-Lentivirus plasmid (NM_020525)

Pre-made Human IL22/IL-21/ IL-22 Lentiviral expression plasmid for IL22 lentivirus packaging, IL22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IL22/IL-21 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002305 Human IL22 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002305
Gene Name IL22
Accession Number NM_020525
Gene ID 50616
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 540 bp
Gene Alias IL-21, IL-22, IL-D110, IL-TIF, ILTIF, TIFa, TIFIL-23, zcyto18
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCGCCCTGCAGAAATCTGTGAGCTCTTTCCTTATGGGGACCCTGGCCACCAGCTGCCTCCTTCTCTTGGCCCTCTTGGTACAGGGAGGAGCAGCTGCGCCCATCAGCTCCCACTGCAGGCTTGACAAGTCCAACTTCCAGCAGCCCTATATCACCAACCGCACCTTCATGCTGGCTAAGGAGGCTAGCTTGGCTGATAACAACACAGACGTTCGTCTCATTGGGGAGAAACTGTTCCACGGAGTCAGTATGAGTGAGCGCTGCTATCTGATGAAGCAGGTGCTGAACTTCACCCTTGAAGAAGTGCTGTTCCCTCAATCTGATAGGTTCCAGCCTTATATGCAGGAGGTGGTGCCCTTCCTGGCCAGGCTCAGCAACAGGCTAAGCACATGTCATATTGAAGGTGATGACCTGCATATCCAGAGGAATGTGCAAAAGCTGAAGGACACAGTGAAAAAGCTTGGAGAGAGTGGAGAGATCAAAGCAATTGGAGAACTGGATTTGCTGTTTATGTCTCTGAGAAATGCCTGCATTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-209 Pre-Made Fezakinumab biosimilar, Whole mAb, Anti-IL22 Antibody: Anti-IL-21/IL-22/IL-D110/IL-TIF/ILTIF/TIFIL-23/TIFa/zcyto18 therapeutic antibody
    Target Antibody GM-Tg-g-T44682-Ab Anti-IL22/ IL-21/ IL-22 functional antibody
    Target Antigen GM-Tg-g-T44682-Ag IL22 protein
    Cytokine cks-Tg-g-GM-T44682 Interleukin 22 (IL22) protein & antibody
    ORF Viral Vector pGMLP002305 Human IL22 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-029 Human IL22 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-112 Human IL22 Adenovirus plasmid
    ORF Viral Vector vGMLP002305 Human IL22 Lentivirus particle
    ORF Viral Vector vGMLP-IL-029 Human IL22 Lentivirus particle
    ORF Viral Vector vGMAP-IL-112 Human IL22 Adenovirus particle


    Target information

    Target ID GM-T44682
    Target Name IL22
    Gene ID 50616, 718047, 500836, 101095184, 481153, 507778, 100058976
    Gene Symbol and Synonyms If2b1,IL-21,IL-22,IL-D110,IL-TIF,IL22,ILTIF,RGD1561292,TIFa,TIFIL-23,zcyto18
    Uniprot Accession Q9GZX6
    Uniprot Entry Name IL22_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000127318
    Target Classification Not Available

    This gene is a member of the IL10 family of cytokines that mediate cellular inflammatory responses. The encoded protein functions in antimicrobial defense at mucosal surfaces and in tissue repair. This protein also has pro-inflammatory properties and plays a role in in the pathogenesis of several intestinal diseases. The encoded protein is a crucial cytokine that regulates host immunity in infectious diseases, including COVID-19 (disease caused by SARS-CoV-2). [provided by RefSeq, Dec 2021]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.