Human IL22/IL-21/ IL-22 ORF/cDNA clone-Lentivirus particle (NM_020525)
Pre-made Human IL22/IL-21/ IL-22 Lentiviral expression plasmid for IL22 lentivirus packaging, IL22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IL22/IL-21 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002305 | Human IL22 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002305 |
Gene Name | IL22 |
Accession Number | NM_020525 |
Gene ID | 50616 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 540 bp |
Gene Alias | IL-21, IL-22, IL-D110, IL-TIF, ILTIF, TIFa, TIFIL-23, zcyto18 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCGCCCTGCAGAAATCTGTGAGCTCTTTCCTTATGGGGACCCTGGCCACCAGCTGCCTCCTTCTCTTGGCCCTCTTGGTACAGGGAGGAGCAGCTGCGCCCATCAGCTCCCACTGCAGGCTTGACAAGTCCAACTTCCAGCAGCCCTATATCACCAACCGCACCTTCATGCTGGCTAAGGAGGCTAGCTTGGCTGATAACAACACAGACGTTCGTCTCATTGGGGAGAAACTGTTCCACGGAGTCAGTATGAGTGAGCGCTGCTATCTGATGAAGCAGGTGCTGAACTTCACCCTTGAAGAAGTGCTGTTCCCTCAATCTGATAGGTTCCAGCCTTATATGCAGGAGGTGGTGCCCTTCCTGGCCAGGCTCAGCAACAGGCTAAGCACATGTCATATTGAAGGTGATGACCTGCATATCCAGAGGAATGTGCAAAAGCTGAAGGACACAGTGAAAAAGCTTGGAGAGAGTGGAGAGATCAAAGCAATTGGAGAACTGGATTTGCTGTTTATGTCTCTGAGAAATGCCTGCATTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-209 | Pre-Made Fezakinumab biosimilar, Whole mAb, Anti-IL22 Antibody: Anti-IL-21/IL-22/IL-D110/IL-TIF/ILTIF/TIFIL-23/TIFa/zcyto18 therapeutic antibody |
Target Antibody | GM-Tg-g-T44682-Ab | Anti-IL22/ IL-21/ IL-22 functional antibody |
Target Antigen | GM-Tg-g-T44682-Ag | IL22 protein |
Cytokine | cks-Tg-g-GM-T44682 | Interleukin 22 (IL22) protein & antibody |
ORF Viral Vector | pGMLP002305 | Human IL22 Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-029 | Human IL22 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-112 | Human IL22 Adenovirus plasmid |
ORF Viral Vector | vGMLP002305 | Human IL22 Lentivirus particle |
ORF Viral Vector | vGMLP-IL-029 | Human IL22 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-112 | Human IL22 Adenovirus particle |
Target information
Target ID | GM-T44682 |
Target Name | IL22 |
Gene ID | 50616, 718047, 500836, 101095184, 481153, 507778, 100058976 |
Gene Symbol and Synonyms | If2b1,IL-21,IL-22,IL-D110,IL-TIF,IL22,ILTIF,RGD1561292,TIFa,TIFIL-23,zcyto18 |
Uniprot Accession | Q9GZX6 |
Uniprot Entry Name | IL22_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000127318 |
Target Classification | Not Available |
This gene is a member of the IL10 family of cytokines that mediate cellular inflammatory responses. The encoded protein functions in antimicrobial defense at mucosal surfaces and in tissue repair. This protein also has pro-inflammatory properties and plays a role in in the pathogenesis of several intestinal diseases. The encoded protein is a crucial cytokine that regulates host immunity in infectious diseases, including COVID-19 (disease caused by SARS-CoV-2). [provided by RefSeq, Dec 2021]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.