Human PPM1A/PP2C-ALPHA/PP2CA ORF/cDNA clone-Lentivirus plasmid (NM_021003)

Cat. No.: pGMLP002446
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PPM1A/PP2C-ALPHA/PP2CA Lentiviral expression plasmid for PPM1A lentivirus packaging, PPM1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PPM1A/PP2C-ALPHA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $621.72
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002446
Gene Name PPM1A
Accession Number NM_021003
Gene ID 5494
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1149 bp
Gene Alias PP2C-ALPHA,PP2CA,PP2Calpha
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGAGCATTTTTAGACAAGCCAAAGATGGAAAAGCATAATGCCCAGGGGCAGGGTAATGGGTTGCGATATGGGCTAAGCAGCATGCAAGGCTGGCGTGTTGAAATGGAGGATGCACATACGGCTGTGATCGGTTTGCCAAGTGGACTTGAATCGTGGTCATTCTTTGCTGTGTATGATGGGCATGCTGGTTCTCAGGTTGCCAAATACTGCTGTGAGCATTTGTTAGATCACATCACCAATAACCAGGATTTTAAAGGGTCTGCAGGAGCACCTTCTGTGGAAAATGTAAAGAATGGAATCAGAACAGGTTTTCTGGAGATTGATGAACACATGAGAGTTATGTCAGAGAAGAAACATGGTGCAGATAGAAGTGGGTCAACAGCTGTAGGTGTCTTAATTTCTCCCCAACATACTTATTTCATTAACTGTGGAGACTCAAGAGGTTTACTTTGTAGGAACAGGAAAGTTCATTTCTTCACACAAGATCACAAACCAAGTAATCCGCTGGAGAAAGAACGAATTCAGAATGCAGGTGGCTCTGTAATGATTCAGCGTGTGAATGGCTCTCTGGCTGTATCGAGGGCCCTTGGGGATTTTGATTACAAATGTGTCCATGGAAAAGGTCCTACTGAGCAGCTTGTCTCACCAGAGCCTGAAGTCCATGATATTGAAAGATCTGAAGAAGATGATCAGTTCATTATCCTTGCATGTGATGGTATCTGGGATGTTATGGGAAATGAAGAGCTCTGTGATTTTGTAAGATCCAGACTTGAAGTCACTGATGACCTTGAGAAAGTTTGCAATGAAGTAGTCGACACCTGTTTGTATAAGGGAAGTCGAGACAACATGAGTGTGATTTTGATCTGTTTTCCAAATGCACCCAAAGTATCGCCAGAAGCAGTGAAGAAGGAGGCAGAGTTGGACAAGTACCTGGAATGCAGAGTAGAAGAAATCATAAAGAAGCAGGGGGAAGGCGTCCCCGACTTAGTCCATGTGATGCGCACATTAGCGAGTGAGAACATCCCCAGCCTCCCACCAGGGGGTGAATTGGCAAGCAAGAGGAATGTTATTGAAGCCGTTTACAATAGACTGAATCCTTACAAAAATGACGACACTGACTCTACATCAACAGATGATATGTGGTAA
ORF Protein Sequence MGAFLDKPKMEKHNAQGQGNGLRYGLSSMQGWRVEMEDAHTAVIGLPSGLESWSFFAVYDGHAGSQVAKYCCEHLLDHITNNQDFKGSAGAPSVENVKNGIRTGFLEIDEHMRVMSEKKHGADRSGSTAVGVLISPQHTYFINCGDSRGLLCRNRKVHFFTQDHKPSNPLEKERIQNAGGSVMIQRVNGSLAVSRALGDFDYKCVHGKGPTEQLVSPEPEVHDIERSEEDDQFIILACDGIWDVMGNEELCDFVRSRLEVTDDLEKVCNEVVDTCLYKGSRDNMSVILICFPNAPKVSPEAVKKEAELDKYLECRVEEIIKKQGEGVPDLVHVMRTLASENIPSLPPGGELASKRNVIEAVYNRLNPYKNDDTDSTSTDDMW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T55260-Ab Anti-PPM1A/ PP2C-ALPHA/ PP2CA monoclonal antibody
    Target Antigen GM-Tg-g-T55260-Ag PPM1A VLP (virus-like particle)
    ORF Viral Vector pGMLP002446 Human PPM1A Lentivirus plasmid
    ORF Viral Vector vGMLP002446 Human PPM1A Lentivirus particle


    Target information

    Target ID GM-T55260
    Target Name PPM1A
    Gene ID 5494, 19042, 702987, 24666, 101101571, 480344, 281994, 100051348
    Gene Symbol and Synonyms 2310003C21Rik,2900017D14Rik,MMPa-2,MPPa-1,PP2C-ALPHA,Pp2c1,PP2CA,PP2Calpha,PPM1A
    Uniprot Accession P35813
    Uniprot Entry Name PPM1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000100614
    Target Classification Not Available

    The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase dephosphorylates, and negatively regulates the activities of, MAP kinases and MAP kinase kinases. It has been shown to inhibit the activation of p38 and JNK kinase cascades induced by environmental stresses. This phosphatase can also dephosphorylate cyclin-dependent kinases, and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to activate the expression of the tumor suppressor gene TP53/p53, which leads to G2/M cell cycle arrest and apoptosis. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.