Human CMPK1/CK/ CMK ORF/cDNA clone-Lentivirus plasmid (NM_016308)

Pre-made Human CMPK1/CK/ CMK Lentiviral expression plasmid for CMPK1 lentivirus packaging, CMPK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CMPK1/CK products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002463 Human CMPK1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002463
Gene Name CMPK1
Accession Number NM_016308
Gene ID 51727
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 687 bp
Gene Alias CK, CMK, CMPK, UMK, UMP-CMPK, UMPK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGAGCCGCTGCCGCAGCGGGCTGCTCCACGTCCTGGGCCTTAGCTTCCTGCTGCAGACCCGCCGGCCGATTCTCCTCTGCTCTCCACGTCTCATGAAGCCGCTGGTCGTGTTCGTCCTCGGCGGCCCCGGCGCCGGCAAGGGGACCCAGTGCGCCCGCATCGTCGAGAAATATGGCTACACACACCTTTCTGCAGGAGAGCTGCTTCGTGATGAAAGGAAGAACCCAGATTCACAGTATGGTGAACTTATTGAAAAGTACATTAAAGAAGGAAAGATTGTACCAGTTGAGATAACCATCAGTTTATTAAAGAGGGAAATGGATCAGACAATGGCTGCCAATGCTCAGAAGAATAAATTCTTGATTGATGGGTTTCCAAGAAATCAAGACAACCTTCAAGGATGGAACAAGACCATGGATGGGAAGGCAGATGTATCTTTCGTTCTCTTTTTTGACTGTAATAATGAGATTTGTATTGAACGATGTCTTGAGAGGGGAAAGAGTAGTGGTAGGAGTGATGACAACAGAGAGAGCTTGGAAAAGAGAATTCAGACCTACCTTCAGTCAACAAAGCCAATTATTGACTTATATGAAGAAATGGGGAAAGTCAAGAAAATAGATGCTTCTAAATCTGTTGATGAAGTTTTTGATGAAGTTGTGCAGATTTTTGACAAGGAAGGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1554-Ab Anti-KCY/ CMPK1/ CK functional antibody
    Target Antigen GM-Tg-g-SE1554-Ag CMPK1 protein
    ORF Viral Vector pGMLP002463 Human CMPK1 Lentivirus plasmid
    ORF Viral Vector vGMLP002463 Human CMPK1 Lentivirus particle


    Target information

    Target ID GM-SE1554
    Target Name CMPK1
    Gene ID 51727, 66588, 710196, 298410, 105260825, 610291, 509965, 100063738
    Gene Symbol and Synonyms 0610011D08Rik,CK,CMK,CMPK,CMPK1,RGD1310116,UMK,UMP-CMPK,UMPK
    Uniprot Accession P30085
    Uniprot Entry Name KCY_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000162368
    Target Classification Not Available

    This gene encodes one of the enzymes required for cellular nucleic acid biosynthesis. This enzyme catalyzes the transfer of a phosphate group from ATP to CMP, UMP, or dCMP, to form the corresponding diphosphate nucleotide. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.