Human CMPK1/CK/CMK ORF/cDNA clone-Lentivirus particle (NM_016308)

Cat. No.: vGMLP002463

Pre-made Human CMPK1/CK/CMK Lentiviral expression plasmid for CMPK1 lentivirus packaging, CMPK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CMPK1/CK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002463 Human CMPK1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002463
Gene Name CMPK1
Accession Number NM_016308
Gene ID 51727
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 687 bp
Gene Alias CK,CMK,CMPK,UMK,UMP-CMPK,UMPK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGAGCCGCTGCCGCAGCGGGCTGCTCCACGTCCTGGGCCTTAGCTTCCTGCTGCAGACCCGCCGGCCGATTCTCCTCTGCTCTCCACGTCTCATGAAGCCGCTGGTCGTGTTCGTCCTCGGCGGCCCCGGCGCCGGCAAGGGGACCCAGTGCGCCCGCATCGTCGAGAAATATGGCTACACACACCTTTCTGCAGGAGAGCTGCTTCGTGATGAAAGGAAGAACCCAGATTCACAGTATGGTGAACTTATTGAAAAGTACATTAAAGAAGGAAAGATTGTACCAGTTGAGATAACCATCAGTTTATTAAAGAGGGAAATGGATCAGACAATGGCTGCCAATGCTCAGAAGAATAAATTCTTGATTGATGGGTTTCCAAGAAATCAAGACAACCTTCAAGGATGGAACAAGACCATGGATGGGAAGGCAGATGTATCTTTCGTTCTCTTTTTTGACTGTAATAATGAGATTTGTATTGAACGATGTCTTGAGAGGGGAAAGAGTAGTGGTAGGAGTGATGACAACAGAGAGAGCTTGGAAAAGAGAATTCAGACCTACCTTCAGTCAACAAAGCCAATTATTGACTTATATGAAGAAATGGGGAAAGTCAAGAAAATAGATGCTTCTAAATCTGTTGATGAAGTTTTTGATGAAGTTGTGCAGATTTTTGACAAGGAAGGCTAA
ORF Protein Sequence MLSRCRSGLLHVLGLSFLLQTRRPILLCSPRLMKPLVVFVLGGPGAGKGTQCARIVEKYGYTHLSAGELLRDERKNPDSQYGELIEKYIKEGKIVPVEITISLLKREMDQTMAANAQKNKFLIDGFPRNQDNLQGWNKTMDGKADVSFVLFFDCNNEICIERCLERGKSSGRSDDNRESLEKRIQTYLQSTKPIIDLYEEMGKVKKIDASKSVDEVFDEVVQIFDKEG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1554-Ab Anti-KCY/ CMPK1/ CK functional antibody
    Target Antigen GM-Tg-g-SE1554-Ag CMPK1 protein
    ORF Viral Vector pGMLP002463 Human CMPK1 Lentivirus plasmid
    ORF Viral Vector vGMLP002463 Human CMPK1 Lentivirus particle


    Target information

    Target ID GM-SE1554
    Target Name CMPK1
    Gene ID 51727, 66588, 710196, 298410, 105260825, 610291, 509965, 100063738
    Gene Symbol and Synonyms 0610011D08Rik,CK,CMK,CMPK,CMPK1,RGD1310116,UMK,UMP-CMPK,UMPK
    Uniprot Accession P30085
    Uniprot Entry Name KCY_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000162368
    Target Classification Not Available

    This gene encodes one of the enzymes required for cellular nucleic acid biosynthesis. This enzyme catalyzes the transfer of a phosphate group from ATP to CMP, UMP, or dCMP, to form the corresponding diphosphate nucleotide. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.