Human STX7 ORF/cDNA clone-Lentivirus plasmid (NM_003569)

Cat. No.: pGMLP002488
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human STX7/ Lentiviral expression plasmid for STX7 lentivirus packaging, STX7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to STX7/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $496.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002488
Gene Name STX7
Accession Number NM_003569
Gene ID 8417
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 786 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTTACACTCCAGGAGTTGGTGGTGACCCCGCCCAGTTGGCCCAGAGGATCTCTTCTAACATCCAGAAGATCACACAGTGTTCTGTGGAAATACAAAGAACTCTGAATCAACTTGGAACACCTCAAGATTCACCTGAATTGAGGCAACAGTTGCAACAGAAGCAGCAGTATACTAACCAGCTTGCCAAAGAAACAGATAAGTACATTAAAGAGTTTGGATCTCTGCCCACCACCCCCAGTGAACAGCGTCAAAGGAAAATACAGAAGGATCGCTTAGTGGCAGAGTTCACAACATCACTGACAAACTTCCAGAAGGTCCAGAGGCAGGCTGCTGAGCGAGAGAAAGAGTTTGTTGCTCGAGTAAGAGCCAGTTCCAGAGTGTCTGGCAGTTTTCCTGAGGACAGCTCAAAAGAAAGGAATCTTGTATCCTGGGAAAGCCAAACTCAACCTCAAGTGCAGGTGCAGGATGAAGAAATTACAGAGGATGACCTCCGTCTTATTCATGAGAGAGAATCTTCTATCAGGCAACTTGAAGCTGATATTATGGATATTAATGAAATATTTAAAGATTTGGGAATGATGATTCATGAACAAGGAGATGTAATAGATAGCATAGAAGCCAATGTGGAAAATGCAGAGGTGCACGTTCAGCAAGCAAATCAGCAGCTGTCAAGGGCAGCAGATTATCAGCGCAAATCCAGAAAAACCCTGTGCATCATCATTCTTATCCTTGTCATTGGAGTTGCGATTATCAGTCTCATCATATGGGGATTGAACCACTGA
ORF Protein Sequence MSYTPGVGGDPAQLAQRISSNIQKITQCSVEIQRTLNQLGTPQDSPELRQQLQQKQQYTNQLAKETDKYIKEFGSLPTTPSEQRQRKIQKDRLVAEFTTSLTNFQKVQRQAAEREKEFVARVRASSRVSGSFPEDSSKERNLVSWESQTQPQVQVQDEEITEDDLRLIHERESSIRQLEADIMDINEIFKDLGMMIHEQGDVIDSIEANVENAEVHVQQANQQLSRAADYQRKSRKTLCIIILILVIGVAIISLIIWGLNH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1730-Ab Anti-STX7 monoclonal antibody
    Target Antigen GM-Tg-g-MP1730-Ag STX7 VLP (virus-like particle)
    ORF Viral Vector pGMLP002488 Human STX7 Lentivirus plasmid
    ORF Viral Vector vGMLP002488 Human STX7 Lentivirus particle


    Target information

    Target ID GM-MP1730
    Target Name STX7
    Gene ID 8417, 53331, 709667, 60466, 101095016, 483987, 507031, 100073104
    Gene Symbol and Synonyms STX7,Syn7,syntaxin-7
    Uniprot Accession O15400
    Uniprot Entry Name STX7_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000079950
    Target Classification Not Available

    The protein encoded by this gene is a syntaxin family membrane receptor involved in vesicle transport. The encoded protein binds alpha-SNAP, an important regulator of transport vesicle fusion. Along with syntaxin 13, this protein plays a role in the ordered fusion of endosomes and lysosomes with the phagosome. [provided by RefSeq, May 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.