Human PPP4C/PP-X/PP4 ORF/cDNA clone-Lentivirus plasmid (NM_002720)

Cat. No.: pGMLP002501
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PPP4C/PP-X/PP4 Lentiviral expression plasmid for PPP4C lentivirus packaging, PPP4C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PPP4C/PP-X products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $531
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002501
Gene Name PPP4C
Accession Number NM_002720
Gene ID 5531
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 924 bp
Gene Alias PP-X,PP4,PP4C,PPH3,PPP4,PPX
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGAGATCAGCGACCTGGACCGGCAGATCGAGCAGCTGCGTCGCTGCGAGCTCATCAAGGAGAGCGAAGTCAAGGCCCTGTGCGCTAAGGCCAGAGAGATCTTGGTAGAGGAGAGCAACGTGCAGAGGGTGGACTCGCCAGTCACAGTGTGCGGCGACATCCATGGACAATTCTATGACCTCAAAGAGCTGTTCAGAGTAGGTGGCGACGTCCCTGAGACCAACTACCTCTTCATGGGGGACTTTGTGGACCGTGGCTTCTATAGCGTCGAAACGTTCCTCCTGCTGCTGGCACTTAAGGTTCGCTATCCTGATCGCATCACACTGATCCGGGGCAACCATGAGAGTCGCCAGATCACGCAGGTCTATGGCTTCTACGATGAGTGCCTGCGCAAGTACGGCTCGGTGACTGTGTGGCGCTACTGCACTGAGATCTTTGACTACCTCAGCCTGTCAGCCATCATCGATGGCAAGATCTTCTGCGTGCACGGGGGCCTCTCCCCCTCCATCCAGACCCTGGATCAGATTCGGACAATCGACCGAAAGCAAGAGGTGCCTCATGATGGGCCCATGTGTGACCTCCTCTGGTCTGACCCAGAAGACACCACAGGCTGGGGCGTGAGCCCCCGAGGAGCCGGCTACCTATTTGGCAGTGACGTGGTGGCCCAGTTCAACGCAGCCAATGACATTGACATGATCTGCCGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACGGTGCTCACTGTGTGGTCGGCACCCAACTACTGCTACCGCTGTGGGAATGTGGCAGCCATCTTGGAGCTGGACGAGCATCTCCAGAAAGATTTCATCATCTTTGAGGCTGCTCCCCAAGAGACACGGGGCATCCCCTCCAAGAAGCCCGTGGCCGACTACTTCCTGTGA
ORF Protein Sequence MAEISDLDRQIEQLRRCELIKESEVKALCAKAREILVEESNVQRVDSPVTVCGDIHGQFYDLKELFRVGGDVPETNYLFMGDFVDRGFYSVETFLLLLALKVRYPDRITLIRGNHESRQITQVYGFYDECLRKYGSVTVWRYCTEIFDYLSLSAIIDGKIFCVHGGLSPSIQTLDQIRTIDRKQEVPHDGPMCDLLWSDPEDTTGWGVSPRGAGYLFGSDVVAQFNAANDIDMICRAHQLVMEGYKWHFNETVLTVWSAPNYCYRCGNVAAILELDEHLQKDFIIFEAAPQETRGIPSKKPVADYFL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2265-Ab Anti-PP4C/ PPP4C/ PP-X monoclonal antibody
    Target Antigen GM-Tg-g-MP2265-Ag PPP4C VLP (virus-like particle)
    ORF Viral Vector pGMLP002501 Human PPP4C Lentivirus plasmid
    ORF Viral Vector vGMLP002501 Human PPP4C Lentivirus particle


    Target information

    Target ID GM-MP2265
    Target Name PPP4C
    Gene ID 5531, 56420, 708510, 171366, 101101530, 489947, 540398, 100064118
    Gene Symbol and Synonyms 1110002D08Rik,PP-X,PP4,PP4C,PPH3,PPP4,PPP4C,PPX
    Uniprot Accession P60510
    Uniprot Entry Name PP4C_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000149923
    Target Classification Not Available

    Enables protein serine/threonine phosphatase activity. Involved in regulation of double-strand break repair via homologous recombination. Located in cytosol; nucleoplasm; and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.