Human DNAJB4/DjB4/DNAJW ORF/cDNA clone-Lentivirus plasmid (NM_007034)

Cat. No.: pGMLP002531
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DNAJB4/DjB4/DNAJW Lentiviral expression plasmid for DNAJB4 lentivirus packaging, DNAJB4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DNAJB4/DjB4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $583.92
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002531
Gene Name DNAJB4
Accession Number NM_007034
Gene ID 11080
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1014 bp
Gene Alias DjB4,DNAJW,HLJ1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAAAGACTATTATTGCATTTTGGGAATTGAGAAAGGAGCTTCAGATGAAGATATTAAAAAGGCTTACCGAAAACAAGCCCTCAAATTTCATCCGGACAAGAACAAATCTCCTCAGGCAGAGGAAAAATTTAAAGAGGTCGCAGAAGCTTATGAAGTATTGAGTGATCCTAAAAAGAGAGAAATATATGATCAGTTTGGGGAGGAAGGGTTGAAAGGAGGAGCAGGAGGTACTGATGGACAAGGAGGTACCTTCCGGTACACCTTTCATGGCGATCCTCATGCTACATTTGCTGCATTTTTCGGAGGGTCCAACCCCTTTGAAATTTTCTTTGGAAGACGAATGGGTGGTGGTAGAGATTCTGAAGAAATGGAAATAGATGGTGATCCTTTTAGTGCCTTTGGTTTCAGCATGAATGGATATCCAAGAGACAGGAATTCTGTGGGGCCATCCCGCCTCAAACAAGATCCTCCAGTTATTCATGAACTTAGAGTATCACTTGAAGAGATATATAGTGGTTGTACCAAACGGATGAAGATTTCTCGAAAAAGGCTAAACGCTGATGGAAGGAGTTACAGATCTGAGGACAAAATTCTTACCATTGAGATTAAAAAAGGGTGGAAAGAAGGCACCAAAATTACTTTTCCAAGAGAAGGAGATGAAACACCAAATAGTATTCCAGCAGACATTGTTTTTATCATTAAAGACAAAGATCATCCAAAATTTAAAAGGGATGGATCAAATATAATTTATACTGCTAAAATTAGTTTACGAGAGGCATTGTGTGGCTGCTCAATTAATGTACCAACACTGGATGGAAGAAACATACCTATGTCAGTAAATGATATTGTGAAACCCGGAATGAGGAGAAGAATTATTGGATATGGGCTGCCATTTCCAAAAAATCCTGACCAACGTGGTGACCTTCTAATAGAATTTGAGGTGTCCTTCCCAGATACTATATCTTCTTCATCCAAAGAAGTACTTAGGAAACATCTTCCTGCCTCATAG
ORF Protein Sequence MGKDYYCILGIEKGASDEDIKKAYRKQALKFHPDKNKSPQAEEKFKEVAEAYEVLSDPKKREIYDQFGEEGLKGGAGGTDGQGGTFRYTFHGDPHATFAAFFGGSNPFEIFFGRRMGGGRDSEEMEIDGDPFSAFGFSMNGYPRDRNSVGPSRLKQDPPVIHELRVSLEEIYSGCTKRMKISRKRLNADGRSYRSEDKILTIEIKKGWKEGTKITFPREGDETPNSIPADIVFIIKDKDHPKFKRDGSNIIYTAKISLREALCGCSINVPTLDGRNIPMSVNDIVKPGMRRRIIGYGLPFPKNPDQRGDLLIEFEVSFPDTISSSSKEVLRKHLPAS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2085-Ab Anti-DNJB4/ DNAJB4/ DNAJW monoclonal antibody
    Target Antigen GM-Tg-g-MP2085-Ag DNAJB4 VLP (virus-like particle)
    ORF Viral Vector pGMLP002531 Human DNAJB4 Lentivirus plasmid
    ORF Viral Vector vGMLP002531 Human DNAJB4 Lentivirus particle


    Target information

    Target ID GM-MP2085
    Target Name DNAJB4
    Gene ID 11080, 67035, 707206, 295549, 101093123, 479982, 541274, 100053123
    Gene Symbol and Synonyms 1700029A20Rik,2010306G19Rik,5730460G06Rik,CMYP21,DjB4,DNAJB4,DNAJW,HLJ1
    Uniprot Accession Q9UDY4
    Uniprot Entry Name DNJB4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000162616
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a molecular chaperone, tumor suppressor, and member of the heat shock protein-40 family. The encoded protein binds the cell adhesion protein E-cadherin and targets it to the plasma membrane. This protein also binds incorrectly folded E-cadherin and targets it for endoplasmic reticulum-associated degradation. This gene is a strong tumor suppressor for colorectal carcinoma, and downregulation of it may serve as a good biomarker for predicting patient outcomes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.