Human HLA-DMA/D6S222E/DMA ORF/cDNA clone-Lentivirus plasmid (NM_006120)

Cat. No.: pGMLP002653
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HLA-DMA/D6S222E/DMA Lentiviral expression plasmid for HLA-DMA lentivirus packaging, HLA-DMA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HLA-DMA/D6S222E products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $496.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002653
Gene Name HLA-DMA
Accession Number NM_006120
Gene ID 3108
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 786 bp
Gene Alias D6S222E,DMA,HLADM,RING6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGTCATGAACAGAACCAAGGAGCTGCGCTGCTACAGATGTTACCACTTCTGTGGCTGCTACCCCACTCCTGGGCCGTCCCTGAAGCTCCTACTCCAATGTGGCCAGATGACCTGCAAAACCACACATTCCTGCACACAGTGTACTGCCAGGATGGGAGTCCCAGTGTGGGACTCTCTGAGGCCTACGACGAGGACCAGCTTTTCTTCTTCGACTTTTCCCAGAACACTCGGGTGCCTCGCCTGCCCGAATTTGCTGACTGGGCTCAGGAACAGGGAGATGCTCCTGCCATTTTATTTGACAAAGAGTTCTGCGAGTGGATGATCCAGCAAATAGGGCCAAAACTTGATGGGAAAATCCCGGTGTCCAGAGGGTTTCCTATCGCTGAAGTGTTCACGCTGAAGCCCCTGGAGTTTGGCAAGCCCAACACTTTGGTCTGTTTTGTCAGTAATCTCTTCCCACCCATGCTGACAGTGAACTGGCAGCATCATTCCGTCCCTGTGGAAGGATTTGGGCCTACTTTTGTCTCAGCTGTCGATGGACTCAGCTTCCAGGCCTTTTCTTACTTAAACTTCACACCAGAACCTTCTGACATTTTCTCCTGCATTGTGACTCACGAAATTGACCGCTACACAGCAATTGCCTATTGGGTACCCCGGAACGCACTGCCCTCAGATCTGCTGGAGAATGTGCTGTGTGGCGTGGCCTTTGGCCTGGGTGTGCTGGGCATCATCGTGGGCATTGTTCTCATCATCTACTTCCGGAAGCCTTGCTCAGGTGACTGA
ORF Protein Sequence MGHEQNQGAALLQMLPLLWLLPHSWAVPEAPTPMWPDDLQNHTFLHTVYCQDGSPSVGLSEAYDEDQLFFFDFSQNTRVPRLPEFADWAQEQGDAPAILFDKEFCEWMIQQIGPKLDGKIPVSRGFPIAEVFTLKPLEFGKPNTLVCFVSNLFPPMLTVNWQHHSVPVEGFGPTFVSAVDGLSFQAFSYLNFTPEPSDIFSCIVTHEIDRYTAIAYWVPRNALPSDLLENVLCGVAFGLGVLGIIVGIVLIIYFRKPCSGD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0970-Ab Anti-HLA-DMA monoclonal antibody
    Target Antigen GM-Tg-g-IP0970-Ag HLA-DMA protein
    ORF Viral Vector pGMLP002653 Human HLA-DMA Lentivirus plasmid
    ORF Viral Vector vGMLP002653 Human HLA-DMA Lentivirus particle


    Target information

    Target ID GM-IP0970
    Target Name HLA-DMA
    Gene ID 3108, 14998, 717870, 294274, 111560443, 481732, 282490, 100061035
    Gene Symbol and Synonyms BOLA-DMA,D6S222E,DLA-DMA,DMA,DMA1,H-2Ma,H2-DMa,H2-Ma,HLA-DMA,HLADM,LOC100061035,LOC111560443,MAMU-DMA,RING6,RT1-DMa,RT1.DMa,RT1.Ma
    Uniprot Accession P28067
    Uniprot Entry Name DMA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000204257
    Target Classification Not Available

    HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.