Human LAMP2/CD107b/ LAMP-2 ORF/cDNA clone-Lentivirus plasmid (NM_013995)

Pre-made Human LAMP2/CD107b/ LAMP-2 Lentiviral expression plasmid for LAMP2 lentivirus packaging, LAMP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to LAMP2/CD107b products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002683 Human LAMP2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002683
Gene Name LAMP2
Accession Number NM_013995
Gene ID 3920
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1233 bp
Gene Alias CD107b, LAMP-2, LAMPB, LGP-96, LGP110
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGCCTAGTCCTGGGAGCTGTGCGGTCTTATGCATTGGAACTTAATTTGACAGATTCAGAAAATGCCACTTGCCTTTATGCAAAATGGCAGATGAATTTCACAGTACGCTATGAAACTACAAATAAAACTTATAAAACTGTAACCATTTCAGACCATGGCACTGTGACATATAATGGAAGCATTTGTGGGGATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGACCTGGCTTTTCCTGGATTGCGAATTTTACCAAGGCAGCATCTACTTATTCAATTGACAGCGTCTCATTTTCCTACAACACTGGTGATAACACAACATTTCCTGATGCTGAAGATAAAGGAATTCTTACTGTTGATGAACTTTTGGCCATCAGAATTCCATTGAATGACCTTTTTAGATGCAATAGTTTATCAACTTTGGAAAAGAATGATGTTGTCCAACACTACTGGGATGTTCTTGTACAAGCTTTTGTCCAAAATGGCACAGTGAGCACAAATGAGTTCCTGTGTGATAAAGACAAAACTTCAACAGTGGCACCCACCATACACACCACTGTGCCATCTCCTACTACAACACCTACTCCAAAGGAAAAACCAGAAGCTGGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGCTGGCTACCATGGGGCTGCAGCTGAACATCACTCAGGATAAGGTTGCTTCAGTTATTAACATCAACCCCAATACAACTCACTCCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAGTATCTAGACTTTGTCTTTGCTGTGAAAAATGAAAACCGATTTTATCTGAAGGAAGTGAACATCAGCATGTATTTGGTTAATGGCTCCGTTTTCAGCATTGCAAATAACAATCTCAGCTACTGGGATGCCCCCCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCATTTCAGATAAATACCTTTGATCTAAGGGTTCAGCCTTTCAATGTGACACAAGGAAAGTATTCTACAGCCCAAGAGTGTTCGCTGGATGATGACACCATTCTAATCCCAATTATAGTTGGTGCTGGTCTTTCAGGCTTGATTATCGTTATAGTGATTGCTTACGTAATTGGCAGAAGAAAAAGTTATGCTGGATATCAGACTCTGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T46052-Ab Anti-LAMP2/ CD107b/ LAMP-2 monoclonal antibody
    Target Antigen GM-Tg-g-T46052-Ag LAMP2 VLP (virus-like particle)
    ORF Viral Vector pGMLP002683 Human LAMP2 Lentivirus plasmid
    ORF Viral Vector vGMLP002683 Human LAMP2 Lentivirus particle


    Target information

    Target ID GM-T46052
    Target Name LAMP2
    Gene ID 3920, 16784, 695379, 24944, 100169945, 481037, 529148, 100061837
    Gene Symbol and Synonyms CD107b,DND,Lamp II,LAMP-2,Lamp-2a,Lamp-2b,Lamp-2c,LAMP2,LAMPB,LGP-96,LGP-B,LGP110,Mac3
    Uniprot Accession P13473
    Uniprot Entry Name LAMP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000005893
    Target Classification Not Available

    The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may play a role in tumor cell metastasis. It may also function in the protection, maintenance, and adhesion of the lysosome. Alternative splicing of this gene results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.