Human VDAC2/POR ORF/cDNA clone-Lentivirus plasmid (NM_001184783)

Pre-made Human VDAC2/POR Lentiviral expression plasmid for VDAC2 lentivirus packaging, VDAC2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to VDAC2/POR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002688 Human VDAC2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002688
Gene Name VDAC2
Accession Number NM_001184783
Gene ID 7417
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 930 bp
Gene Alias POR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCTGGTGTAATGAGCTCAGATTGCCTGCCCTTAAGCAGCACAGCATTGGCCGAGGACTTGAGAGTCACATTACAATGTGTATTCCTCCATCATATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAGGATTTGGTTTTGGGTTGGTGAAACTGGATGTGAAAACAAAGTCTTGCAGTGGCGTGGAATTTTCAACGTCCGGTTCATCTAATACAGACACTGGTAAAGTTACTGGGACCTTGGAGACCAAATACAAGTGGTGTGAGTATGGTCTGACTTTCACAGAAAAGTGGAACACTGATAACACTCTGGGAACAGAAATCGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACATTTGATACTACCTTCTCACCAAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTTCTTACAAGAGGGAGTGTATAAACCTTGGTTGTGATGTTGACTTTGATTTTGCTGGACCTGCAATCCATGGTTCAGCTGTCTTTGGTTATGAGGGCTGGCTTGCTGGCTACCAGATGACCTTTGACAGTGCCAAATCAAAGCTGACAAGGAATAACTTTGCAGTGGGCTACAGGACTGGGGACTTCCAGCTACACACTAATGTCAATGATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTTTGTGAAGATCTTGACACTTCAGTAAACCTTGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATATCAGTTGGATCCCACTGCTTCCATTTCTGCAAAAGTCAACAACTCTAGCTTAATTGGAGTAGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTCTCTGCTCTGGTAGATGGGAAGAGCATTAATGCTGGAGGCCACAAGGTTGGGCTCGCCCTGGAGTTGGAGGCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0121-Ab Anti-VDAC2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0121-Ag VDAC2 protein
    ORF Viral Vector pGMLV000368 Human VDAC2 Lentivirus plasmid
    ORF Viral Vector pGMLV000985 Human VDAC2 Lentivirus plasmid
    ORF Viral Vector pGMLP002688 Human VDAC2 Lentivirus plasmid
    ORF Viral Vector pGMAP000584 Human VDAC2 Adenovirus plasmid
    ORF Viral Vector vGMLV000368 Human VDAC2 Lentivirus particle
    ORF Viral Vector vGMLV000985 Human VDAC2 Lentivirus particle
    ORF Viral Vector vGMLP002688 Human VDAC2 Lentivirus particle
    ORF Viral Vector vGMAP000584 Human VDAC2 Adenovirus particle


    Target information

    Target ID GM-IP0121
    Target Name VDAC2
    Gene ID 7417, 22334, 704257, 83531, 101092793, 479255, 282120, 100064276
    Gene Symbol and Synonyms mVDAC2,mVDAC6,POR,VDAC2,Vdac6
    Uniprot Accession P45880
    Uniprot Entry Name VDAC2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000165637
    Target Classification Not Available

    This gene encodes a member of the voltage-dependent anion channel pore-forming family of proteins that are considered the main pathway for metabolite diffusion across the mitochondrial outer membrane. The encoded protein is also thought to be involved in the mitochondrial apoptotic pathway via regulation of BCL2-antagonist/killer 1 protein activity. Pseudogenes have been identified on chromosomes 1, 2, 12 and 21, and alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.