Human VDAC2/POR ORF/cDNA clone-Adenovirus particle (NM_001184783.1)
Pre-made Human VDAC2/POR Adenovirus for VDAC2 overexpression in-vitro and in-vivo. The VDAC2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified VDAC2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to VDAC2/POR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000584 | Human VDAC2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000584 |
Gene Name | VDAC2 |
Accession Number | NM_001184783.1 |
Gene ID | 7417 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 930 bp |
Gene Alias | POR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCTGGTGTAATGAGCTCAGATTGCCTGCCCTTAAGCAGCACAGCATTGGCCGAGGACTTGAGAGTCACATTACAATGTGTATTCCTCCATCATATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAGGATTTGGTTTTGGGTTGGTGAAACTGGATGTGAAAACAAAGTCTTGCAGTGGCGTGGAATTTTCAACGTCCGGTTCATCTAATACAGACACTGGTAAAGTTACTGGGACCTTGGAGACCAAATACAAGTGGTGTGAGTATGGTCTGACTTTCACAGAAAAGTGGAACACTGATAACACTCTGGGAACAGAAATCGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACATTTGATACTACCTTCTCACCAAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTTCTTACAAGAGGGAGTGTATAAACCTTGGTTGTGATGTTGACTTTGATTTTGCTGGACCTGCAATCCATGGTTCAGCTGTCTTTGGTTATGAGGGCTGGCTTGCTGGCTACCAGATGACCTTTGACAGTGCCAAATCAAAGCTGACAAGGAATAACTTTGCAGTGGGCTACAGGACTGGGGACTTCCAGCTACACACTAATGTCAATGATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTTTGTGAAGATCTTGACACTTCAGTAAACCTTGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATATCAGTTGGATCCCACTGCTTCCATTTCTGCAAAAGTCAACAACTCTAGCTTAATTGGAGTAGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTCTCTGCTCTGGTAGATGGGAAGAGCATTAATGCTGGAGGCCACAAGGTTGGGCTCGCCCTGGAGTTGGAGGCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0121-Ab | Anti-VDAC2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0121-Ag | VDAC2 protein |
ORF Viral Vector | pGMLV000368 | Human VDAC2 Lentivirus plasmid |
ORF Viral Vector | pGMLV000985 | Human VDAC2 Lentivirus plasmid |
ORF Viral Vector | pGMLP002688 | Human VDAC2 Lentivirus plasmid |
ORF Viral Vector | pGMAP000584 | Human VDAC2 Adenovirus plasmid |
ORF Viral Vector | vGMLV000368 | Human VDAC2 Lentivirus particle |
ORF Viral Vector | vGMLV000985 | Human VDAC2 Lentivirus particle |
ORF Viral Vector | vGMLP002688 | Human VDAC2 Lentivirus particle |
ORF Viral Vector | vGMAP000584 | Human VDAC2 Adenovirus particle |
Target information
Target ID | GM-IP0121 |
Target Name | VDAC2 |
Gene ID | 7417, 22334, 704257, 83531, 101092793, 479255, 282120, 100064276 |
Gene Symbol and Synonyms | mVDAC2,mVDAC6,POR,VDAC2,Vdac6 |
Uniprot Accession | P45880 |
Uniprot Entry Name | VDAC2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000165637 |
Target Classification | Not Available |
This gene encodes a member of the voltage-dependent anion channel pore-forming family of proteins that are considered the main pathway for metabolite diffusion across the mitochondrial outer membrane. The encoded protein is also thought to be involved in the mitochondrial apoptotic pathway via regulation of BCL2-antagonist/killer 1 protein activity. Pseudogenes have been identified on chromosomes 1, 2, 12 and 21, and alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.