Human HSD11B1/11-beta-HSD1/ 11-DH ORF/cDNA clone-Lentivirus plasmid (NM_005525)
Pre-made Human HSD11B1/11-beta-HSD1/ 11-DH Lentiviral expression plasmid for HSD11B1 lentivirus packaging, HSD11B1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HSD11B1/11-beta-HSD1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002767 | Human HSD11B1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002767 |
Gene Name | HSD11B1 |
Accession Number | NM_005525 |
Gene ID | 3290 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 879 bp |
Gene Alias | 11-beta-HSD1, 11-DH, CORTRD2, HDL, HSD11, HSD11B, HSD11L, SDR26C1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTTTATGAAAAAATATCTCCTCCCCATTCTGGGGCTCTTCATGGCCTACTACTACTATTCTGCAAACGAGGAATTCAGACCAGAGATGCTCCAAGGAAAGAAAGTGATTGTCACAGGGGCCAGCAAAGGGATCGGAAGAGAGATGGCTTATCATCTGGCGAAGATGGGAGCCCATGTGGTGGTGACAGCGAGGTCAAAAGAAACTCTACAGAAGGTGGTATCCCACTGCCTGGAGCTTGGAGCAGCCTCAGCACACTACATTGCTGGCACCATGGAAGACATGACCTTCGCAGAGCAATTTGTTGCCCAAGCAGGAAAGCTCATGGGAGGACTAGACATGCTCATTCTCAACCACATCACCAACACTTCTTTGAATCTTTTTCATGATGATATTCACCATGTGCGCAAAAGCATGGAAGTCAACTTCCTCAGTTACGTGGTCCTGACTGTAGCTGCCTTGCCCATGCTGAAGCAGAGCAATGGAAGCATTGTTGTCGTCTCCTCTCTGGCTGGGAAAGTGGCTTATCCAATGGTTGCTGCCTATTCTGCAAGCAAGTTTGCTTTGGATGGGTTCTTCTCCTCCATCAGAAAGGAATATTCAGTGTCCAGGGTCAATGTATCAATCACTCTCTGTGTTCTTGGCCTCATAGACACAGAAACAGCCATGAAGGCAGTTTCTGGGATAGTCCATATGCAAGCAGCTCCAAAGGAGGAATGTGCCCTGGAGATCATCAAAGGGGGAGCTCTGCGCCAAGAAGAAGTGTATTATGACAGCTCACTCTGGACCACTCTTCTGATCAGAAATCCATGCAGGAAGATCCTGGAATTTCTCTACTCAACGAGCTATAATATGGACAGATTCATAAACAAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0040-Ab | Anti-HSD11B1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0040-Ag | HSD11B1 protein |
ORF Viral Vector | pGMLP002767 | Human HSD11B1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002767 | Human HSD11B1 Lentivirus particle |
Target information
Target ID | GM-IP0040 |
Target Name | HSD11B1 |
Gene ID | 3290, 15483, 574322, 25116, 100529248, 449023, 282589, 100056429 |
Gene Symbol and Synonyms | 11-beta-HSD1,11-DH,11HSD1,CORTRD2,HDL,HSD11,HSD11B,HSD11B1,HSD11L,LRRGT00065,SDR26C1 |
Uniprot Accession | P28845 |
Uniprot Entry Name | DHI1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000117594 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.