Human IL17F/CANDF6/ IL-17F ORF/cDNA clone-Lentivirus plasmid (NM_052872)

Pre-made Human IL17F/CANDF6/ IL-17F Lentiviral expression plasmid for IL17F lentivirus packaging, IL17F lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IL17F/CANDF6 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002770 Human IL17F Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002770
Gene Name IL17F
Accession Number NM_052872
Gene ID 112744
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 492 bp
Gene Alias CANDF6, IL-17F, ML-1, ML1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACAGTGAAGACCCTGCATGGCCCAGCCATGGTCAAGTACTTGCTGCTGTCGATATTGGGGCTTGCCTTTCTGAGTGAGGCGGCAGCTCGGAAAATCCCCAAAGTAGGACATACTTTTTTCCAAAAGCCTGAGAGTTGCCCGCCTGTGCCAGGAGGTAGTATGAAGCTTGACATTGGCATCATCAATGAAAACCAGCGCGTTTCCATGTCACGTAACATCGAGAGCCGCTCCACCTCCCCCTGGAATTACACTGTCACTTGGGACCCCAACCGGTACCCCTCGGAAGTTGTACAGGCCCAGTGTAGGAACTTGGGCTGCATCAATGCTCAAGGAAAGGAAGACATCTCCATGAATTCCGTTCCCATCCAGCAAGAGACCCTGGTCGTCCGGAGGAAGCACCAAGGCTGCTCTGTTTCTTTCCAGTTGGAGAAGGTGCTGGTGACTGTTGGCTGCACCTGCGTCACCCCTGTCATCCACCATGTGCAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-996 Pre-Made Sonelokimab Biosimilar, Bispecific, Anti-ALB;IL17A/IL17;IL17F Antibody: Anti-FDAHT/HSA/PRO0883/PRO0903/PRO1341;CTLA-8/CTLA8/IL-17A/ILA17;CANDF6/ML-1/ML1 therapeutic antibody
    Target Antibody GM-Tg-g-T06542-Ab Anti-IL17F/ CANDF6/ IL-17F functional antibody
    Target Antigen GM-Tg-g-T06542-Ag IL17F protein
    Cytokine cks-Tg-g-GM-T06542 Interleukin 17F (IL17F) protein & antibody
    ORF Viral Vector pGMLP002770 Human IL17F Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-024 Human IL17F Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-107 Human IL17F Adenovirus plasmid
    ORF Viral Vector vGMLP002770 Human IL17F Lentivirus particle
    ORF Viral Vector vGMLP-IL-024 Human IL17F Lentivirus particle
    ORF Viral Vector vGMAP-IL-107 Human IL17F Adenovirus particle


    Target information

    Target ID GM-T06542
    Target Name IL17F
    Gene ID 112744, 257630, 708220, 301291, 101095826, 481838, 506030, 100069094
    Gene Symbol and Synonyms CANDF6,IL-17F,IL17A,IL17F,ML-1,ML1
    Uniprot Accession Q96PD4
    Uniprot Entry Name IL17F_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000112116
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.