Human IL17F/CANDF6/ IL-17F ORF/cDNA clone-Lentivirus particle (NM_052872)
Pre-made Human IL17F/CANDF6/ IL-17F Lentiviral expression plasmid for IL17F lentivirus packaging, IL17F lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IL17F/CANDF6 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002770 | Human IL17F Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002770 |
Gene Name | IL17F |
Accession Number | NM_052872 |
Gene ID | 112744 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 492 bp |
Gene Alias | CANDF6, IL-17F, ML-1, ML1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACAGTGAAGACCCTGCATGGCCCAGCCATGGTCAAGTACTTGCTGCTGTCGATATTGGGGCTTGCCTTTCTGAGTGAGGCGGCAGCTCGGAAAATCCCCAAAGTAGGACATACTTTTTTCCAAAAGCCTGAGAGTTGCCCGCCTGTGCCAGGAGGTAGTATGAAGCTTGACATTGGCATCATCAATGAAAACCAGCGCGTTTCCATGTCACGTAACATCGAGAGCCGCTCCACCTCCCCCTGGAATTACACTGTCACTTGGGACCCCAACCGGTACCCCTCGGAAGTTGTACAGGCCCAGTGTAGGAACTTGGGCTGCATCAATGCTCAAGGAAAGGAAGACATCTCCATGAATTCCGTTCCCATCCAGCAAGAGACCCTGGTCGTCCGGAGGAAGCACCAAGGCTGCTCTGTTTCTTTCCAGTTGGAGAAGGTGCTGGTGACTGTTGGCTGCACCTGCGTCACCCCTGTCATCCACCATGTGCAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-996 | Pre-Made Sonelokimab Biosimilar, Bispecific, Anti-ALB;IL17A/IL17;IL17F Antibody: Anti-FDAHT/HSA/PRO0883/PRO0903/PRO1341;CTLA-8/CTLA8/IL-17A/ILA17;CANDF6/ML-1/ML1 therapeutic antibody |
Target Antibody | GM-Tg-g-T06542-Ab | Anti-IL17F/ CANDF6/ IL-17F functional antibody |
Target Antigen | GM-Tg-g-T06542-Ag | IL17F protein |
Cytokine | cks-Tg-g-GM-T06542 | Interleukin 17F (IL17F) protein & antibody |
ORF Viral Vector | pGMLP002770 | Human IL17F Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-024 | Human IL17F Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-107 | Human IL17F Adenovirus plasmid |
ORF Viral Vector | vGMLP002770 | Human IL17F Lentivirus particle |
ORF Viral Vector | vGMLP-IL-024 | Human IL17F Lentivirus particle |
ORF Viral Vector | vGMAP-IL-107 | Human IL17F Adenovirus particle |
Target information
Target ID | GM-T06542 |
Target Name | IL17F |
Gene ID | 112744, 257630, 708220, 301291, 101095826, 481838, 506030, 100069094 |
Gene Symbol and Synonyms | CANDF6,IL-17F,IL17A,IL17F,ML-1,ML1 |
Uniprot Accession | Q96PD4 |
Uniprot Entry Name | IL17F_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000112116 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.