Human SERPINA3/AACT/ACT ORF/cDNA clone-Lentivirus plasmid (NM_001085)
Cat. No.: pGMLP002808
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SERPINA3/AACT/ACT Lentiviral expression plasmid for SERPINA3 lentivirus packaging, SERPINA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SERPINA3/AACT products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002808 |
Gene Name | SERPINA3 |
Accession Number | NM_001085 |
Gene ID | 12 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1272 bp |
Gene Alias | AACT,ACT,GIG24,GIG25 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGAGAGAATGTTACCTCTCCTGGCTCTGGGGCTCTTGGCGGCTGGGTTCTGCCCTGCTGTCCTCTGCCACCCTAACAGCCCACTTGACGAGGAGAATCTGACCCAGGAGAACCAAGACCGAGGGACACACGTGGACCTCGGATTAGCCTCCGCCAACGTGGACTTCGCTTTCAGCCTGTACAAGCAGTTAGTCCTGAAGGCCCCTGATAAGAATGTCATCTTCTCCCCACTGAGCATCTCCACCGCCTTGGCCTTCCTGTCTCTGGGGGCCCATAATACCACCCTGACAGAGATTCTCAAAGGCCTCAAGTTCAACCTCACGGAGACTTCTGAGGCAGAAATTCACCAGAGCTTCCAGCACCTCCTGCGCACCCTCAATCAGTCCAGCGATGAGCTGCAGCTGAGTATGGGAAATGCCATGTTTGTCAAAGAGCAACTCAGTCTGCTGGACAGGTTCACGGAGGATGCCAAGAGGCTGTATGGCTCCGAGGCCTTTGCCACTGACTTTCAGGACTCAGCTGCAGCTAAGAAGCTCATCAACGACTACGTGAAGAATGGAACTAGGGGGAAAATCACAGATCTGATCAAGGACCTTGACTCGCAGACAATGATGGTCCTGGTGAATTACATCTTCTTTAAAGCCAAATGGGAGATGCCCTTTGACCCCCAAGATACTCATCAGTCAAGGTTCTACTTGAGCAAGAAAAAGTGGGTAATGGTGCCCATGATGAGTTTGCATCACCTGACTATACCTTACTTCCGGGACGAGGAGCTGTCCTGCACCGTGGTGGAGCTGAAGTACACAGGCAATGCCAGCGCACTCTTCATCCTCCCTGATCAAGACAAGATGGAGGAAGTGGAAGCCATGCTGCTCCCAGAGACCCTGAAGCGGTGGAGAGACTCTCTGGAGTTCAGAGAGATAGGTGAGCTCTACCTGCCAAAGTTTTCCATCTCGAGGGACTATAACCTGAACGACATACTTCTCCAGCTGGGCATTGAGGAAGCCTTCACCAGCAAGGCTGACCTGTCAGGGATCACAGGGGCCAGGAACCTAGCAGTCTCCCAGGTGGTCCATAAGGCTGTGCTTGATGTATTTGAGGAGGGCACAGAAGCATCTGCTGCCACAGCAGTCAAAATCACCCTCCTTTCTGCATTAGTGGAGACAAGGACCATTGTGCGTTTCAACAGGCCCTTCCTGATGATCATTGTCCCTACAGACACCCAGAACATCTTCTTCATGAGCAAAGTCACCAATCCCAAGCAAGCCTAG |
ORF Protein Sequence | MERMLPLLALGLLAAGFCPAVLCHPNSPLDEENLTQENQDRGTHVDLGLASANVDFAFSLYKQLVLKAPDKNVIFSPLSISTALAFLSLGAHNTTLTEILKGLKFNLTETSEAEIHQSFQHLLRTLNQSSDELQLSMGNAMFVKEQLSLLDRFTEDAKRLYGSEAFATDFQDSAAAKKLINDYVKNGTRGKITDLIKDLDSQTMMVLVNYIFFKAKWEMPFDPQDTHQSRFYLSKKKWVMVPMMSLHHLTIPYFRDEELSCTVVELKYTGNASALFILPDQDKMEEVEAMLLPETLKRWRDSLEFREIGELYLPKFSISRDYNLNDILLQLGIEEAFTSKADLSGITGARNLAVSQVVHKAVLDVFEEGTEASAATAVKITLLSALVETRTIVRFNRPFLMIIVPTDTQNIFFMSKVTNPKQA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0467-Ab | Anti-AACT/ SERPINA3/ ACT functional antibody |
Target Antigen | GM-Tg-g-SE0467-Ag | SERPINA3 protein |
ORF Viral Vector | pGMLP002808 | Human SERPINA3 Lentivirus plasmid |
ORF Viral Vector | vGMLP002808 | Human SERPINA3 Lentivirus particle |
Target information
Target ID | GM-SE0467 |
Target Name | SERPINA3 |
Gene ID | 12, 574106, 101089197, 480425, 100053600 |
Gene Symbol and Synonyms | AACT,ACT,GIG24,GIG25,SERPINA3 |
Uniprot Accession | P01011 |
Uniprot Entry Name | AACT_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Diabetes type-2, Diabetic Nephropathy, Kidney transplant rejection, Non-small cell lung carcinoma, Acute appendicitis |
Gene Ensembl | ENSG00000196136 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. Polymorphisms in this protein appear to be tissue specific and influence protease targeting. Variations in this protein's sequence have been implicated in Alzheimer's disease, and deficiency of this protein has been associated with liver disease. Mutations have been identified in patients with Parkinson disease and chronic obstructive pulmonary disease. [provided by RefSeq, Jun 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.