Human SERPINA3/AACT/ACT ORF/cDNA clone-Lentivirus plasmid (NM_001085)

Cat. No.: pGMLP002808
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SERPINA3/AACT/ACT Lentiviral expression plasmid for SERPINA3 lentivirus packaging, SERPINA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SERPINA3/AACT products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $656.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002808
Gene Name SERPINA3
Accession Number NM_001085
Gene ID 12
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1272 bp
Gene Alias AACT,ACT,GIG24,GIG25
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGAGAATGTTACCTCTCCTGGCTCTGGGGCTCTTGGCGGCTGGGTTCTGCCCTGCTGTCCTCTGCCACCCTAACAGCCCACTTGACGAGGAGAATCTGACCCAGGAGAACCAAGACCGAGGGACACACGTGGACCTCGGATTAGCCTCCGCCAACGTGGACTTCGCTTTCAGCCTGTACAAGCAGTTAGTCCTGAAGGCCCCTGATAAGAATGTCATCTTCTCCCCACTGAGCATCTCCACCGCCTTGGCCTTCCTGTCTCTGGGGGCCCATAATACCACCCTGACAGAGATTCTCAAAGGCCTCAAGTTCAACCTCACGGAGACTTCTGAGGCAGAAATTCACCAGAGCTTCCAGCACCTCCTGCGCACCCTCAATCAGTCCAGCGATGAGCTGCAGCTGAGTATGGGAAATGCCATGTTTGTCAAAGAGCAACTCAGTCTGCTGGACAGGTTCACGGAGGATGCCAAGAGGCTGTATGGCTCCGAGGCCTTTGCCACTGACTTTCAGGACTCAGCTGCAGCTAAGAAGCTCATCAACGACTACGTGAAGAATGGAACTAGGGGGAAAATCACAGATCTGATCAAGGACCTTGACTCGCAGACAATGATGGTCCTGGTGAATTACATCTTCTTTAAAGCCAAATGGGAGATGCCCTTTGACCCCCAAGATACTCATCAGTCAAGGTTCTACTTGAGCAAGAAAAAGTGGGTAATGGTGCCCATGATGAGTTTGCATCACCTGACTATACCTTACTTCCGGGACGAGGAGCTGTCCTGCACCGTGGTGGAGCTGAAGTACACAGGCAATGCCAGCGCACTCTTCATCCTCCCTGATCAAGACAAGATGGAGGAAGTGGAAGCCATGCTGCTCCCAGAGACCCTGAAGCGGTGGAGAGACTCTCTGGAGTTCAGAGAGATAGGTGAGCTCTACCTGCCAAAGTTTTCCATCTCGAGGGACTATAACCTGAACGACATACTTCTCCAGCTGGGCATTGAGGAAGCCTTCACCAGCAAGGCTGACCTGTCAGGGATCACAGGGGCCAGGAACCTAGCAGTCTCCCAGGTGGTCCATAAGGCTGTGCTTGATGTATTTGAGGAGGGCACAGAAGCATCTGCTGCCACAGCAGTCAAAATCACCCTCCTTTCTGCATTAGTGGAGACAAGGACCATTGTGCGTTTCAACAGGCCCTTCCTGATGATCATTGTCCCTACAGACACCCAGAACATCTTCTTCATGAGCAAAGTCACCAATCCCAAGCAAGCCTAG
ORF Protein Sequence MERMLPLLALGLLAAGFCPAVLCHPNSPLDEENLTQENQDRGTHVDLGLASANVDFAFSLYKQLVLKAPDKNVIFSPLSISTALAFLSLGAHNTTLTEILKGLKFNLTETSEAEIHQSFQHLLRTLNQSSDELQLSMGNAMFVKEQLSLLDRFTEDAKRLYGSEAFATDFQDSAAAKKLINDYVKNGTRGKITDLIKDLDSQTMMVLVNYIFFKAKWEMPFDPQDTHQSRFYLSKKKWVMVPMMSLHHLTIPYFRDEELSCTVVELKYTGNASALFILPDQDKMEEVEAMLLPETLKRWRDSLEFREIGELYLPKFSISRDYNLNDILLQLGIEEAFTSKADLSGITGARNLAVSQVVHKAVLDVFEEGTEASAATAVKITLLSALVETRTIVRFNRPFLMIIVPTDTQNIFFMSKVTNPKQA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0467-Ab Anti-AACT/ SERPINA3/ ACT functional antibody
    Target Antigen GM-Tg-g-SE0467-Ag SERPINA3 protein
    ORF Viral Vector pGMLP002808 Human SERPINA3 Lentivirus plasmid
    ORF Viral Vector vGMLP002808 Human SERPINA3 Lentivirus particle


    Target information

    Target ID GM-SE0467
    Target Name SERPINA3
    Gene ID 12, 574106, 101089197, 480425, 100053600
    Gene Symbol and Synonyms AACT,ACT,GIG24,GIG25,SERPINA3
    Uniprot Accession P01011
    Uniprot Entry Name AACT_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Diabetes type-2, Diabetic Nephropathy, Kidney transplant rejection, Non-small cell lung carcinoma, Acute appendicitis
    Gene Ensembl ENSG00000196136
    Target Classification Not Available

    The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. Polymorphisms in this protein appear to be tissue specific and influence protease targeting. Variations in this protein's sequence have been implicated in Alzheimer's disease, and deficiency of this protein has been associated with liver disease. Mutations have been identified in patients with Parkinson disease and chronic obstructive pulmonary disease. [provided by RefSeq, Jun 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.