Human TFPI2/PP5/REF1 ORF/cDNA clone-Lentivirus plasmid (NM_006528)
Cat. No.: pGMLP002824
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TFPI2/PP5/REF1 Lentiviral expression plasmid for TFPI2 lentivirus packaging, TFPI2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TFPI2/PP5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002824 |
Gene Name | TFPI2 |
Accession Number | NM_006528 |
Gene ID | 7980 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 708 bp |
Gene Alias | PP5,REF1,TFPI-2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGACCCCGCTCGCCCCCTGGGGCTGTCGATTCTGCTGCTTTTCCTGACGGAGGCTGCACTGGGCGATGCTGCTCAGGAGCCAACAGGAAATAACGCGGAGATCTGTCTCCTGCCCCTAGACTACGGACCCTGCCGGGCCCTACTTCTCCGTTACTACTACGACAGGTACACGCAGAGCTGCCGCCAGTTCCTGTACGGGGGCTGCGAGGGCAACGCCAACAATTTCTACACCTGGGAGGCTTGCGACGATGCTTGCTGGAGGATAGAAAAAGTTCCCAAAGTTTGCCGGCTGCAAGTGAGTGTGGACGACCAGTGTGAGGGGTCCACAGAAAAGTATTTCTTTAATCTAAGTTCCATGACATGTGAAAAATTCTTTTCCGGTGGGTGTCACCGGAACCGGATTGAGAACAGGTTTCCAGATGAAGCTACTTGTATGGGCTTCTGCGCACCAAAGAAAATTCCATCATTTTGCTACAGTCCAAAAGATGAGGGACTGTGCTCTGCCAATGTGACTCGCTATTATTTTAATCCAAGATACAGAACCTGTGATGCTTTCACCTATACTGGCTGTGGAGGGAATGACAATAACTTTGTTAGCAGGGAGGATTGCAAACGTGCATGTGCAAAAGCTTTGAAAAAGAAAAAGAAGATGCCAAAGCTTCGCTTTGCCAGTAGAATCCGGAAAATTCGGAAGAAGCAATTTTAA |
ORF Protein Sequence | MDPARPLGLSILLLFLTEAALGDAAQEPTGNNAEICLLPLDYGPCRALLLRYYYDRYTQSCRQFLYGGCEGNANNFYTWEACDDACWRIEKVPKVCRLQVSVDDQCEGSTEKYFFNLSSMTCEKFFSGGCHRNRIENRFPDEATCMGFCAPKKIPSFCYSPKDEGLCSANVTRYYFNPRYRTCDAFTYTGCGGNDNNFVSREDCKRACAKALKKKKKMPKLRFASRIRKIRKKQF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0499-Ab | Anti-TFPI2/ PP5/ REF1 functional antibody |
Target Antigen | GM-Tg-g-SE0499-Ag | TFPI2 protein |
ORF Viral Vector | pGMLP002824 | Human TFPI2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002824 | Human TFPI2 Lentivirus particle |
Target information
Target ID | GM-SE0499 |
Target Name | TFPI2 |
Gene ID | 7980, 21789, 700850, 286926, 101088228, 475230, 360007, 100051361 |
Gene Symbol and Synonyms | PP5,PP5/TFPI-2,REF1,TFPI-2,TFPI2 |
Uniprot Accession | P48307 |
Uniprot Entry Name | TFPI2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000105825 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the Kunitz-type serine proteinase inhibitor family. The protein can inhibit a variety of serine proteases including factor VIIa/tissue factor, factor Xa, plasmin, trypsin, chymotryspin and plasma kallikrein. This gene has been identified as a tumor suppressor gene in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.