Human TFPI2/PP5/REF1 ORF/cDNA clone-Lentivirus particle (NM_006528)

Cat. No.: vGMLP002824

Pre-made Human TFPI2/PP5/REF1 Lentiviral expression plasmid for TFPI2 lentivirus packaging, TFPI2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TFPI2/PP5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002824 Human TFPI2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002824
Gene Name TFPI2
Accession Number NM_006528
Gene ID 7980
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 708 bp
Gene Alias PP5,REF1,TFPI-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACCCCGCTCGCCCCCTGGGGCTGTCGATTCTGCTGCTTTTCCTGACGGAGGCTGCACTGGGCGATGCTGCTCAGGAGCCAACAGGAAATAACGCGGAGATCTGTCTCCTGCCCCTAGACTACGGACCCTGCCGGGCCCTACTTCTCCGTTACTACTACGACAGGTACACGCAGAGCTGCCGCCAGTTCCTGTACGGGGGCTGCGAGGGCAACGCCAACAATTTCTACACCTGGGAGGCTTGCGACGATGCTTGCTGGAGGATAGAAAAAGTTCCCAAAGTTTGCCGGCTGCAAGTGAGTGTGGACGACCAGTGTGAGGGGTCCACAGAAAAGTATTTCTTTAATCTAAGTTCCATGACATGTGAAAAATTCTTTTCCGGTGGGTGTCACCGGAACCGGATTGAGAACAGGTTTCCAGATGAAGCTACTTGTATGGGCTTCTGCGCACCAAAGAAAATTCCATCATTTTGCTACAGTCCAAAAGATGAGGGACTGTGCTCTGCCAATGTGACTCGCTATTATTTTAATCCAAGATACAGAACCTGTGATGCTTTCACCTATACTGGCTGTGGAGGGAATGACAATAACTTTGTTAGCAGGGAGGATTGCAAACGTGCATGTGCAAAAGCTTTGAAAAAGAAAAAGAAGATGCCAAAGCTTCGCTTTGCCAGTAGAATCCGGAAAATTCGGAAGAAGCAATTTTAA
ORF Protein Sequence MDPARPLGLSILLLFLTEAALGDAAQEPTGNNAEICLLPLDYGPCRALLLRYYYDRYTQSCRQFLYGGCEGNANNFYTWEACDDACWRIEKVPKVCRLQVSVDDQCEGSTEKYFFNLSSMTCEKFFSGGCHRNRIENRFPDEATCMGFCAPKKIPSFCYSPKDEGLCSANVTRYYFNPRYRTCDAFTYTGCGGNDNNFVSREDCKRACAKALKKKKKMPKLRFASRIRKIRKKQF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0499-Ab Anti-TFPI2/ PP5/ REF1 functional antibody
    Target Antigen GM-Tg-g-SE0499-Ag TFPI2 protein
    ORF Viral Vector pGMLP002824 Human TFPI2 Lentivirus plasmid
    ORF Viral Vector vGMLP002824 Human TFPI2 Lentivirus particle


    Target information

    Target ID GM-SE0499
    Target Name TFPI2
    Gene ID 7980, 21789, 700850, 286926, 101088228, 475230, 360007, 100051361
    Gene Symbol and Synonyms PP5,PP5/TFPI-2,REF1,TFPI-2,TFPI2
    Uniprot Accession P48307
    Uniprot Entry Name TFPI2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000105825
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the Kunitz-type serine proteinase inhibitor family. The protein can inhibit a variety of serine proteases including factor VIIa/tissue factor, factor Xa, plasmin, trypsin, chymotryspin and plasma kallikrein. This gene has been identified as a tumor suppressor gene in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.