Human EREG/Ep/ EPR ORF/cDNA clone-Lentivirus plasmid (NM_001432)
Pre-made Human EREG/Ep/ EPR Lentiviral expression plasmid for EREG lentivirus packaging, EREG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to EREG/Ep products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002843 | Human EREG Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002843 |
Gene Name | EREG |
Accession Number | NM_001432 |
Gene ID | 2069 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 510 bp |
Gene Alias | Ep, EPR, ER |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCGCGGGGAGGAGGATGGAGATGCTCTGTGCCGGCAGGGTCCCTGCGCTGCTGCTCTGCCTGGGTTTCCATCTTCTACAGGCAGTCCTCAGTACAACTGTGATTCCATCATGTATCCCAGGAGAGTCCAGTGATAACTGCACAGCTTTAGTTCAGACAGAAGACAATCCACGTGTGGCTCAAGTGTCAATAACAAAGTGTAGCTCTGACATGAATGGCTATTGTTTGCATGGACAGTGCATCTATCTGGTGGACATGAGTCAAAACTACTGCAGGTGTGAAGTGGGTTATACTGGTGTCCGATGTGAACACTTCTTTTTAACCGTCCACCAACCTTTAAGCAAAGAATATGTGGCTTTGACCGTGATTCTTATTATTTTGTTTCTTATCACAGTCGTCGGTTCCACATATTATTTCTGCAGATGGTACAGAAATCGAAAAAGTAAAGAACCAAAGAAGGAATATGAGAGAGTTACCTCAGGGGATCCAGAGTTGCCGCAAGTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T79157-Ab | Anti-EREG/ EPR/ ER functional antibody |
Target Antigen | GM-Tg-g-T79157-Ag | EREG protein |
Cytokine | cks-Tg-g-GM-T79157 | epiregulin (EREG) protein & antibody |
ORF Viral Vector | pGMLP002843 | Human EREG Lentivirus plasmid |
ORF Viral Vector | vGMLP002843 | Human EREG Lentivirus particle |
Target information
Target ID | GM-T79157 |
Target Name | EREG |
Gene ID | 2069, 13874, 702502, 59325, 101093102, 611946, 100295476, 100056605 |
Gene Symbol and Synonyms | Ep,EPR,ER,EREG |
Uniprot Accession | O14944 |
Uniprot Entry Name | EREG_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000124882 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a secreted peptide hormone and member of the epidermal growth factor (EGF) family of proteins. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and the structurally related erb-b2 receptor tyrosine kinase 4 (ERBB4). The encoded protein may be involved in a wide range of biological processes including inflammation, wound healing, oocyte maturation, and cell proliferation. Additionally, the encoded protein may promote the progression of cancers of various human tissues. [provided by RefSeq, Jul 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.