Human KCNA1/AEMK/EA1 ORF/cDNA clone-Lentivirus plasmid (NM_000217)

Cat. No.: pGMLP002852
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNA1/AEMK/EA1 Lentiviral expression plasmid for KCNA1 lentivirus packaging, KCNA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KCNA1/AEMK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $716.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002852
Gene Name KCNA1
Accession Number NM_000217
Gene ID 3736
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1488 bp
Gene Alias AEMK,EA1,HBK1,HUK1,KV1.1,MBK1,MK1,RBK1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACGGTGATGTCTGGGGAGAACGTGGACGAGGCTTCGGCCGCCCCGGGCCACCCCCAGGATGGCAGCTACCCCCGGCAGGCCGACCACGACGACCACGAGTGCTGCGAGCGCGTGGTGATCAACATCTCCGGGCTGCGCTTCGAGACGCAGCTCAAGACCCTGGCGCAGTTCCCCAACACGCTGCTGGGCAACCCTAAGAAACGCATGCGCTACTTCGACCCCCTGAGGAACGAGTACTTCTTCGACCGCAACCGGCCCAGCTTCGACGCCATCCTCTACTACTACCAGTCCGGCGGCCGCCTGCGGAGGCCGGTCAACGTGCCCCTGGACATGTTCTCCGAGGAGATCAAGTTTTACGAGTTGGGCGAGGAGGCCATGGAGAAGTTCCGGGAGGACGAGGGCTTCATCAAGGAGGAGGAGCGCCCTCTGCCCGAGAAGGAGTACCAGCGCCAGGTGTGGCTGCTCTTCGAGTACCCCGAGAGCTCGGGGCCCGCCAGGGTCATCGCCATCGTCTCCGTCATGGTCATCCTCATCTCCATCGTCATCTTTTGCCTGGAGACGCTCCCCGAGCTGAAGGATGACAAGGACTTCACGGGCACCGTCCACCGCATCGACAACACCACGGTCATCTACAATTCCAACATCTTCACAGACCCCTTCTTCATCGTGGAAACGCTGTGTATCATCTGGTTCTCCTTCGAGCTGGTGGTGCGCTTCTTCGCCTGCCCCAGCAAGACGGACTTCTTCAAAAACATCATGAACTTCATAGACATTGTGGCCATCATTCCTTATTTCATCACGCTGGGCACCGAGATAGCTGAGCAGGAAGGAAACCAGAAGGGCGAGCAGGCCACCTCCCTGGCCATCCTCAGGGTCATCCGCTTGGTAAGGGTTTTTAGAATCTTCAAGCTCTCCCGCCACTCTAAGGGCCTCCAGATCCTGGGCCAGACCCTCAAAGCTAGTATGAGAGAGCTAGGGCTGCTCATCTTTTTCCTCTTCATCGGGGTCATCCTGTTTTCTAGTGCAGTGTACTTTGCCGAGGCGGAAGAAGCTGAGTCGCACTTCTCCAGTATCCCCGATGCTTTCTGGTGGGCGGTGGTGTCCATGACCACTGTAGGATACGGTGACATGTACCCTGTGACAATTGGAGGCAAGATCGTGGGCTCCTTGTGTGCCATCGCTGGTGTGCTAACAATTGCCCTGCCCGTACCTGTCATTGTGTCCAATTTCAACTATTTCTACCACCGAGAAACTGAGGGGGAAGAGCAGGCTCAGTTGCTCCACGTCAGTTCCCCTAACTTAGCCTCTGACAGTGACCTCAGTCGCCGCAGTTCCTCTACTATGAGCAAGTCTGAGTACATGGAGATCGAAGAGGATATGAATAATAGCATAGCCCATTATAGACAGGTCAATATCAGAACTGCCAATTGCACCACTGCTAACCAAAACTGCGTTAATAAGAGCAAGCTACTGACCGATGTTTAA
ORF Protein Sequence MTVMSGENVDEASAAPGHPQDGSYPRQADHDDHECCERVVINISGLRFETQLKTLAQFPNTLLGNPKKRMRYFDPLRNEYFFDRNRPSFDAILYYYQSGGRLRRPVNVPLDMFSEEIKFYELGEEAMEKFREDEGFIKEEERPLPEKEYQRQVWLLFEYPESSGPARVIAIVSVMVILISIVIFCLETLPELKDDKDFTGTVHRIDNTTVIYNSNIFTDPFFIVETLCIIWFSFELVVRFFACPSKTDFFKNIMNFIDIVAIIPYFITLGTEIAEQEGNQKGEQATSLAILRVIRLVRVFRIFKLSRHSKGLQILGQTLKASMRELGLLIFFLFIGVILFSSAVYFAEAEEAESHFSSIPDAFWWAVVSMTTVGYGDMYPVTIGGKIVGSLCAIAGVLTIALPVPVIVSNFNYFYHRETEGEEQAQLLHVSSPNLASDSDLSRRSSSTMSKSEYMEIEEDMNNSIAHYRQVNIRTANCTTANQNCVNKSKLLTDV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85272-Ab Anti-KCNA1/ AEMK/ EA1 monoclonal antibody
    Target Antigen GM-Tg-g-T85272-Ag KCNA1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002852 Human KCNA1 Lentivirus plasmid
    ORF Viral Vector vGMLP002852 Human KCNA1 Lentivirus particle


    Target information

    Target ID GM-T85272
    Target Name KCNA1
    Gene ID 3736, 16485, 711718, 24520, 101093364, 486732, 538703, 100051648
    Gene Symbol and Synonyms AEMK,EA1,HBK1,HUK1,Kca1-1,Kcna,KCNA1,Kcpvd,KV1.1,MBK1,mceph,Mk-1,MK1,RBK1,Shak
    Uniprot Accession Q09470
    Uniprot Entry Name KCNA1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000111262
    Target Classification Ion Channel

    This gene encodes a voltage-gated delayed potassium channel that is phylogenetically related to the Drosophila Shaker channel. The encoded protein has six putative transmembrane segments (S1-S6), and the loop between S5 and S6 forms the pore and contains the conserved selectivity filter motif (GYGD). The functional channel is a homotetramer. The N-terminus of the channel is associated with beta subunits that can modify the inactivation properties of the channel as well as affect expression levels. The C-terminus of the channel is complexed to a PDZ domain protein that is responsible for channel targeting. Mutations in this gene have been associated with myokymia with periodic ataxia (AEMK). [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.