Human LOX/AAT10 ORF/cDNA clone-Lentivirus plasmid (NM_002317)

Cat. No.: pGMLP002864
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LOX/AAT10 Lentiviral expression plasmid for LOX lentivirus packaging, LOX lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LOX/AAT10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $651.12
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002864
Gene Name LOX
Accession Number NM_002317
Gene ID 4015
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1254 bp
Gene Alias AAT10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGCTTCGCCTGGACCGTGCTCCTGCTCGGGCCTTTGCAGCTCTGCGCGCTAGTGCACTGCGCCCCTCCCGCCGCCGGCCAACAGCAGCCCCCGCGCGAGCCGCCGGCGGCTCCGGGCGCCTGGCGCCAGCAGATCCAATGGGAGAACAACGGGCAGGTGTTCAGCTTGCTGAGCCTGGGCTCACAGTACCAGCCTCAGCGCCGCCGGGACCCGGGCGCCGCCGTCCCTGGTGCAGCCAACGCCTCCGCCCAGCAGCCCCGCACTCCGATCCTGCTGATCCGCGACAACCGCACCGCCGCGGCGCGAACGCGGACGGCCGGCTCATCTGGAGTCACCGCTGGCCGCCCCAGGCCCACCGCCCGTCACTGGTTCCAAGCTGGCTACTCGACATCTAGAGCCCGCGAAGCTGGCGCCTCGCGCGCGGAGAACCAGACAGCGCCGGGAGAAGTTCCTGCGCTCAGTAACCTGCGGCCGCCCAGCCGCGTGGACGGCATGGTGGGCGACGACCCTTACAACCCCTACAAGTACTCTGACGACAACCCTTATTACAACTACTACGATACTTATGAAAGGCCCAGACCTGGGGGCAGGTACCGGCCCGGATACGGCACTGGCTACTTCCAGTACGGTCTCCCAGACCTGGTGGCCGACCCCTACTACATCCAGGCGTCCACGTACGTGCAGAAGATGTCCATGTACAACCTGAGATGCGCGGCGGAGGAAAACTGTCTGGCCAGTACAGCATACAGGGCAGATGTCAGAGATTATGATCACAGGGTGCTGCTCAGATTTCCCCAAAGAGTGAAAAACCAAGGGACATCAGATTTCTTACCCAGCCGACCAAGATATTCCTGGGAATGGCACAGTTGTCATCAACATTACCACAGTATGGATGAGTTTAGCCACTATGACCTGCTTGATGCCAACACCCAGAGGAGAGTGGCTGAAGGCCACAAAGCAAGTTTCTGTCTTGAAGACACATCCTGTGACTATGGCTACCACAGGCGATTTGCATGTACTGCACACACACAGGGATTGAGTCCTGGCTGTTATGATACCTATGGTGCAGACATAGACTGCCAGTGGATTGATATTACAGATGTAAAACCTGGAAACTATATCCTAAAGGTCAGTGTAAACCCCAGCTACCTGGTTCCTGAATCTGACTATACCAACAATGTTGTGCGCTGTGACATTCGCTACACAGGACATCATGCGTATGCCTCAGGCTGCACAATTTCACCGTATTAG
ORF Protein Sequence MRFAWTVLLLGPLQLCALVHCAPPAAGQQQPPREPPAAPGAWRQQIQWENNGQVFSLLSLGSQYQPQRRRDPGAAVPGAANASAQQPRTPILLIRDNRTAAARTRTAGSSGVTAGRPRPTARHWFQAGYSTSRAREAGASRAENQTAPGEVPALSNLRPPSRVDGMVGDDPYNPYKYSDDNPYYNYYDTYERPRPGGRYRPGYGTGYFQYGLPDLVADPYYIQASTYVQKMSMYNLRCAAEENCLASTAYRADVRDYDHRVLLRFPQRVKNQGTSDFLPSRPRYSWEWHSCHQHYHSMDEFSHYDLLDANTQRRVAEGHKASFCLEDTSCDYGYHRRFACTAHTQGLSPGCYDTYGADIDCQWIDITDVKPGNYILKVSVNPSYLVPESDYTNNVVRCDIRYTGHHAYASGCTISPY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T75152-Ab Anti-LYOX/ LOX/ AAT10 functional antibody
    Target Antigen GM-Tg-g-T75152-Ag LOX protein
    ORF Viral Vector pGMLP002864 Human LOX Lentivirus plasmid
    ORF Viral Vector pGMPC001488 Human LOX Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004739 Human LOX Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002864 Human LOX Lentivirus particle


    Target information

    Target ID GM-T75152
    Target Name LOX
    Gene ID 4015, 16948, 699997, 24914, 101092985, 481478, 280841, 100064016
    Gene Symbol and Synonyms AAT10,H-rev142,LOX,rrg,Rrg1,TSC-160
    Uniprot Accession P28300
    Uniprot Entry Name LYOX_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000113083
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the lysyl oxidase family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a regulatory propeptide and the mature enzyme. The copper-dependent amine oxidase activity of this enzyme functions in the crosslinking of collagens and elastin, while the propeptide may play a role in tumor suppression. In addition, defects in this gene have been linked with predisposition to thoracic aortic aneurysms and dissections. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.