Human LOX/AAT10 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002317)
Cat. No.: pGMPC004739
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human LOX/AAT10 Non-Viral expression plasmid (overexpression vector) for mouse LOX overexpression in unique cell transient transfection and stable cell line development.
Go to
LOX/AAT10 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMPC004739 |
Gene Name | LOX |
Accession Number | NM_002317 |
Gene ID | 4015 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1254 bp |
Gene Alias | AAT10 |
Fluorescent Reporter | mCherry |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCGCTTCGCCTGGACCGTGCTCCTGCTCGGGCCTTTGCAGCTCTGCGCGCTAGTGCACTGCGCCCCTCCCGCCGCCGGCCAACAGCAGCCCCCGCGCGAGCCGCCGGCGGCTCCGGGCGCCTGGCGCCAGCAGATCCAATGGGAGAACAACGGGCAGGTGTTCAGCTTGCTGAGCCTGGGCTCACAGTACCAGCCTCAGCGCCGCCGGGACCCGGGCGCCGCCGTCCCTGGTGCAGCCAACGCCTCCGCCCAGCAGCCCCGCACTCCGATCCTGCTGATCCGCGACAACCGCACCGCCGCGGCGCGAACGCGGACGGCCGGCTCATCTGGAGTCACCGCTGGCCGCCCCAGGCCCACCGCCCGTCACTGGTTCCAAGCTGGCTACTCGACATCTAGAGCCCGCGAAGCTGGCGCCTCGCGCGCGGAGAACCAGACAGCGCCGGGAGAAGTTCCTGCGCTCAGTAACCTGCGGCCGCCCAGCCGCGTGGACGGCATGGTGGGCGACGACCCTTACAACCCCTACAAGTACTCTGACGACAACCCTTATTACAACTACTACGATACTTATGAAAGGCCCAGACCTGGGGGCAGGTACCGGCCCGGATACGGCACTGGCTACTTCCAGTACGGTCTCCCAGACCTGGTGGCCGACCCCTACTACATCCAGGCGTCCACGTACGTGCAGAAGATGTCCATGTACAACCTGAGATGCGCGGCGGAGGAAAACTGTCTGGCCAGTACAGCATACAGGGCAGATGTCAGAGATTATGATCACAGGGTGCTGCTCAGATTTCCCCAAAGAGTGAAAAACCAAGGGACATCAGATTTCTTACCCAGCCGACCAAGATATTCCTGGGAATGGCACAGTTGTCATCAACATTACCACAGTATGGATGAGTTTAGCCACTATGACCTGCTTGATGCCAACACCCAGAGGAGAGTGGCTGAAGGCCACAAAGCAAGTTTCTGTCTTGAAGACACATCCTGTGACTATGGCTACCACAGGCGATTTGCATGTACTGCACACACACAGGGATTGAGTCCTGGCTGTTATGATACCTATGGTGCAGACATAGACTGCCAGTGGATTGATATTACAGATGTAAAACCTGGAAACTATATCCTAAAGGTCAGTGTAAACCCCAGCTACCTGGTTCCTGAATCTGACTATACCAACAATGTTGTGCGCTGTGACATTCGCTACACAGGACATCATGCGTATGCCTCAGGCTGCACAATTTCACCGTATTAG |
ORF Protein Sequence | MRFAWTVLLLGPLQLCALVHCAPPAAGQQQPPREPPAAPGAWRQQIQWENNGQVFSLLSLGSQYQPQRRRDPGAAVPGAANASAQQPRTPILLIRDNRTAAARTRTAGSSGVTAGRPRPTARHWFQAGYSTSRAREAGASRAENQTAPGEVPALSNLRPPSRVDGMVGDDPYNPYKYSDDNPYYNYYDTYERPRPGGRYRPGYGTGYFQYGLPDLVADPYYIQASTYVQKMSMYNLRCAAEENCLASTAYRADVRDYDHRVLLRFPQRVKNQGTSDFLPSRPRYSWEWHSCHQHYHSMDEFSHYDLLDANTQRRVAEGHKASFCLEDTSCDYGYHRRFACTAHTQGLSPGCYDTYGADIDCQWIDITDVKPGNYILKVSVNPSYLVPESDYTNNVVRCDIRYTGHHAYASGCTISPY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T75152-Ab | Anti-LYOX/ LOX/ AAT10 functional antibody |
Target Antigen | GM-Tg-g-T75152-Ag | LOX protein |
ORF Viral Vector | pGMLP002864 | Human LOX Lentivirus plasmid |
ORF Viral Vector | pGMPC001488 | Human LOX Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC004739 | Human LOX Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP002864 | Human LOX Lentivirus particle |
Target information
Target ID | GM-T75152 |
Target Name | LOX |
Gene ID | 4015, 16948, 699997, 24914, 101092985, 481478, 280841, 100064016 |
Gene Symbol and Synonyms | AAT10,H-rev142,LOX,rrg,Rrg1,TSC-160 |
Uniprot Accession | P28300 |
Uniprot Entry Name | LYOX_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000113083 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the lysyl oxidase family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a regulatory propeptide and the mature enzyme. The copper-dependent amine oxidase activity of this enzyme functions in the crosslinking of collagens and elastin, while the propeptide may play a role in tumor suppression. In addition, defects in this gene have been linked with predisposition to thoracic aortic aneurysms and dissections. [provided by RefSeq, Jul 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.