Human TNNI3/CMD1FF/ CMD2A ORF/cDNA clone-Lentivirus plasmid (NM_000363)

Pre-made Human TNNI3/CMD1FF/ CMD2A Lentiviral expression plasmid for TNNI3 lentivirus packaging, TNNI3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNNI3/CMD1FF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002894 Human TNNI3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002894
Gene Name TNNI3
Accession Number NM_000363
Gene ID 7137
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 633 bp
Gene Alias CMD1FF, CMD2A, CMH7, cTnI, RCM1, TNNC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGATGGGAGCAGCGATGCGGCTAGGGAACCTCGCCCTGCACCAGCCCCAATCAGACGCCGCTCCTCCAACTACCGCGCTTATGCCACGGAGCCGCACGCCAAGAAAAAATCTAAGATCTCCGCCTCGAGAAAATTGCAGCTGAAGACTCTGCTGCTGCAGATTGCAAAGCAAGAGCTGGAGCGAGAGGCGGAGGAGCGGCGCGGAGAGAAGGGGCGCGCTCTGAGCACCCGCTGCCAGCCGCTGGAGTTGGCCGGGCTGGGCTTCGCGGAGCTGCAGGACTTGTGCCGACAGCTCCACGCCCGTGTGGACAAGGTGGATGAAGAGAGATACGACATAGAGGCAAAAGTCACCAAGAACATCACGGAGATTGCAGATCTGACTCAGAAGATCTTTGACCTTCGAGGCAAGTTTAAGCGGCCCACCCTGCGGAGAGTGAGGATCTCTGCAGATGCCATGATGCAGGCGCTGCTGGGGGCCCGGGCTAAGGAGTCCCTGGACCTGCGGGCCCACCTCAAGCAGGTGAAGAAGGAGGACACCGAGAAGGAAAACCGGGAGGTGGGAGACTGGCGCAAGAACATCGATGCACTGAGTGGAATGGAGGGCCGCAAGAAAAAGTTTGAGAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T20186-Ab Anti-TNNI3 monoclonal antibody
    Target Antigen GM-Tg-g-T20186-Ag TNNI3 protein
    ORF Viral Vector pGMAD001056 Rat Tnni3 Adenovirus plasmid
    ORF Viral Vector pGMLP002894 Human TNNI3 Lentivirus plasmid
    ORF Viral Vector vGMAD001056 Rat Tnni3 Adenovirus particle
    ORF Viral Vector vGMLP002894 Human TNNI3 Lentivirus particle


    Target information

    Target ID GM-T20186
    Target Name TNNI3
    Gene ID 7137, 21954, 698470, 29248, 493744, 403566, 511094, 100034065
    Gene Symbol and Synonyms CMD1FF,CMD2A,CMH7,cTnI,RCM1,Tn1,TnI,TNNC1,TNNI3
    Uniprot Accession P19429
    Uniprot Entry Name TNNI3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000129991
    Target Classification Not Available

    Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). Troponin I is useful in making a diagnosis of heart failure, and of ischemic heart disease. An elevated level of troponin is also now used as indicator of acute myocardial injury in patients hospitalized with moderate/severe Coronavirus Disease 2019 (COVID-19). Such elevation has also been associated with higher risk of mortality in cardiovascular disease patients hospitalized due to COVID-19. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.