Human IL2RA/CD25/IDDM10 ORF/cDNA clone-Lentivirus plasmid (NM_000417)

Cat. No.: pGMLP002911
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL2RA/CD25/IDDM10 Lentiviral expression plasmid for IL2RA lentivirus packaging, IL2RA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IL2RA/CD25 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $504.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002911
Gene Name IL2RA
Accession Number NM_000417
Gene ID 3559
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 819 bp
Gene Alias CD25,IDDM10,IL2R,IMD41,p55,TCGFR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATTCATACCTGCTGATGTGGGGACTGCTCACGTTCATCATGGTGCCTGGCTGCCAGGCAGAGCTCTGTGACGATGACCCGCCAGAGATCCCACACGCCACATTCAAAGCCATGGCCTACAAGGAAGGAACCATGTTGAACTGTGAATGCAAGAGAGGTTTCCGCAGAATAAAAAGCGGGTCACTCTATATGCTCTGTACAGGAAACTCTAGCCACTCGTCCTGGGACAACCAATGTCAATGCACAAGCTCTGCCACTCGGAACACAACGAAACAAGTGACACCTCAACCTGAAGAACAGAAAGAAAGGAAAACCACAGAAATGCAAAGTCCAATGCAGCCAGTGGACCAAGCGAGCCTTCCAGGTCACTGCAGGGAACCTCCACCATGGGAAAATGAAGCCACAGAGAGAATTTATCATTTCGTGGTGGGGCAGATGGTTTATTATCAGTGCGTCCAGGGATACAGGGCTCTACACAGAGGTCCTGCTGAGAGCGTCTGCAAAATGACCCACGGGAAGACAAGGTGGACCCAGCCCCAGCTCATATGCACAGGTGAAATGGAGACCAGTCAGTTTCCAGGTGAAGAGAAGCCTCAGGCAAGCCCCGAAGGCCGTCCTGAGAGTGAGACTTCCTGCCTCGTCACAACAACAGATTTTCAAATACAGACAGAAATGGCTGCAACCATGGAGACGTCCATATTTACAACAGAGTACCAGGTAGCAGTGGCCGGCTGTGTTTTCCTGCTGATCAGCGTCCTCCTCCTGAGTGGGCTCACCTGGCAGCGGAGACAGAGGAAGAGTAGAAGAACAATCTAG
ORF Protein Sequence MDSYLLMWGLLTFIMVPGCQAELCDDDPPEIPHATFKAMAYKEGTMLNCECKRGFRRIKSGSLYMLCTGNSSHSSWDNQCQCTSSATRNTTKQVTPQPEEQKERKTTEMQSPMQPVDQASLPGHCREPPPWENEATERIYHFVVGQMVYYQCVQGYRALHRGPAESVCKMTHGKTRWTQPQLICTGEMETSQFPGEEKPQASPEGRPESETSCLVTTTDFQIQTEMAATMETSIFTTEYQVAVAGCVFLLISVLLLSGLTWQRRQRKSRRTI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-907 Pre-Made Melredableukin Alfa Biosimilar, Fusion Protein targeting IL2RA fused with human IL2 (interleukin 2, IL-2) via a peptidyl linker: Recombinant therapeutic protein targeting CD25/IDDM10/IL2R/IMD41/TCGFR/p55
    Biosimilar GMP-Bios-INN-926 Pre-Made Nemvaleukin Alfa Biosimilar, Fusion Protein targeting IL2RA fused with human IL2RA (interleukin 2 receptor alpha subunit, IL-2RA, TAC, p55, CD25) 139-303 (1-165): Recombinant therapeutic protein targeting CD25/IDDM10/IL2R/IMD41/TCGFR/p55
    Biosimilar GMP-Bios-INN-768 Pre-Made Camidanlumab Tesirine Biosimilar, Whole Mab Adc, Anti-Il2Ra Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-INN-789 Pre-Made Daclizumab Beta Biosimilar, Whole Mab, Anti-Il2Ra Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-ab-129 Pre-Made Daclizumab biosimilar, Whole mAb, Anti-IL2RA Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-ab-049 Pre-Made Basiliximab biosimilar, Whole mAb, Anti-IL2RA Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-INN-867 Pre-Made Inolimomab Biosimilar, Whole Mab, Anti-Il2Ra Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Biosimilar GMP-Bios-ab-089 Pre-Made Camidanlumab biosimilar, Whole mAb ADC, Anti-IL2RA Antibody: Anti-CD25/IDDM10/IL2R/IMD41/TCGFR/p55 therapeutic antibody
    Target Antibody GM-Tg-g-T03313-Ab Anti-IL2RA/ CD25/ IDDM10 monoclonal antibody
    Target Antigen GM-Tg-g-T03313-Ag IL2RA VLP (virus-like particle)
    ORF Viral Vector pGMLP002911 Human IL2RA Lentivirus plasmid
    ORF Viral Vector vGMLP002911 Human IL2RA Lentivirus particle


    Target information

    Target ID GM-T03313
    Target Name IL2RA
    Gene ID 3559, 16184, 574300, 25704, 493953, 403870, 281861, 100070292
    Gene Symbol and Synonyms CD25,IDDM10,IL-2RA,IL2R,IL2RA,IL2RAC,IMD41,Ly-43,p55,TCGFR
    Uniprot Accession P01589
    Uniprot Entry Name IL2RA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Ovary Cancer
    Gene Ensembl ENSG00000134460
    Target Classification Checkpoint-Immuno Oncology

    The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency. Patients with severe Coronavirus Disease 2019 (COVID-19), the disease caused by the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), have significantly elevated levels of IL2R in their plasma. Similarly, serum IL-2R levels are found to be elevated in patients with different types of carcinomas. Certain IL2RA and IL2RB gene polymorphisms have been associated with lung cancer risk. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.