Human SLC25A4/AAC1/ ANT ORF/cDNA clone-Lentivirus plasmid (NM_001151)
Pre-made Human SLC25A4/AAC1/ ANT Lentiviral expression plasmid for SLC25A4 lentivirus packaging, SLC25A4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SLC25A4/AAC1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002929 | Human SLC25A4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002929 |
Gene Name | SLC25A4 |
Accession Number | NM_001151 |
Gene ID | 291 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 897 bp |
Gene Alias | AAC1, ANT, ANT 1, ANT1, MTDPS12, MTDPS12A, PEO2, PEO3, PEOA2, T1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGTGATCACGCTTGGAGCTTCCTAAAGGACTTCCTGGCCGGGGGCGTCGCCGCTGCCGTCTCCAAGACCGCGGTCGCCCCCATCGAGAGGGTCAAACTGCTGCTGCAGGTCCAGCATGCCAGCAAACAGATCAGTGCTGAGAAGCAGTACAAAGGGATCATTGATTGTGTGGTGAGAATCCCTAAGGAGCAGGGCTTCCTCTCCTTCTGGAGGGGTAACCTGGCCAACGTGATCCGTTACTTCCCCACCCAAGCTCTCAACTTCGCCTTCAAGGACAAGTACAAGCAGCTCTTCTTAGGGGGTGTGGATCGGCATAAGCAGTTCTGGCGCTACTTTGCTGGTAACCTGGCGTCCGGTGGGGCCGCTGGGGCCACCTCCCTTTGCTTTGTCTACCCGCTGGACTTTGCTAGGACCAGGTTGGCTGCTGATGTGGGCAAGGGCGCCGCCCAGCGTGAGTTCCATGGTCTGGGCGACTGTATCATCAAGATCTTCAAGTCTGATGGCCTGAGGGGGCTCTACCAGGGTTTCAACGTCTCTGTCCAAGGCATCATTATCTATAGAGCTGCCTACTTCGGAGTCTATGATACTGCCAAGGGGATGCTGCCTGACCCCAAGAACGTGCACATTTTTGTGAGCTGGATGATTGCCCAGAGTGTGACGGCAGTCGCAGGGCTGGTGTCCTACCCCTTTGACACTGTTCGTCGTAGAATGATGATGCAGTCCGGCCGGAAAGGGGCCGATATTATGTACACGGGGACAGTTGACTGCTGGAGGAAGATTGCAAAAGACGAAGGAGCCAAGGCCTTCTTCAAAGGTGCCTGGTCCAATGTGCTGAGAGGCATGGGCGGTGCTTTTGTATTGGTGTTGTATGATGAGATCAAAAAATATGTCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0026-Ab | Anti-SLC25A4 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0026-Ag | SLC25A4 protein |
ORF Viral Vector | pGMLP002929 | Human SLC25A4 Lentivirus plasmid |
ORF Viral Vector | vGMLP002929 | Human SLC25A4 Lentivirus particle |
Target information
Target ID | GM-IP0026 |
Target Name | SLC25A4 |
Gene ID | 291, 11739, 695102, 85333, 101096309, 475630, 282478, 100050762 |
Gene Symbol and Synonyms | AAC1,ANT,ANT 1,ANT1,mANC1,MTDPS12,MTDPS12A,PEO2,PEO3,PEOA2,SLC25A4,T1 |
Uniprot Accession | P12235 |
Uniprot Entry Name | ADT1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000151729 |
Target Classification | Not Available |
This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.