Human SLC25A4/AAC1/ ANT ORF/cDNA clone-Lentivirus particle (NM_001151)

Pre-made Human SLC25A4/AAC1/ ANT Lentiviral expression plasmid for SLC25A4 lentivirus packaging, SLC25A4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SLC25A4/AAC1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002929 Human SLC25A4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002929
Gene Name SLC25A4
Accession Number NM_001151
Gene ID 291
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 897 bp
Gene Alias AAC1, ANT, ANT 1, ANT1, MTDPS12, MTDPS12A, PEO2, PEO3, PEOA2, T1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGTGATCACGCTTGGAGCTTCCTAAAGGACTTCCTGGCCGGGGGCGTCGCCGCTGCCGTCTCCAAGACCGCGGTCGCCCCCATCGAGAGGGTCAAACTGCTGCTGCAGGTCCAGCATGCCAGCAAACAGATCAGTGCTGAGAAGCAGTACAAAGGGATCATTGATTGTGTGGTGAGAATCCCTAAGGAGCAGGGCTTCCTCTCCTTCTGGAGGGGTAACCTGGCCAACGTGATCCGTTACTTCCCCACCCAAGCTCTCAACTTCGCCTTCAAGGACAAGTACAAGCAGCTCTTCTTAGGGGGTGTGGATCGGCATAAGCAGTTCTGGCGCTACTTTGCTGGTAACCTGGCGTCCGGTGGGGCCGCTGGGGCCACCTCCCTTTGCTTTGTCTACCCGCTGGACTTTGCTAGGACCAGGTTGGCTGCTGATGTGGGCAAGGGCGCCGCCCAGCGTGAGTTCCATGGTCTGGGCGACTGTATCATCAAGATCTTCAAGTCTGATGGCCTGAGGGGGCTCTACCAGGGTTTCAACGTCTCTGTCCAAGGCATCATTATCTATAGAGCTGCCTACTTCGGAGTCTATGATACTGCCAAGGGGATGCTGCCTGACCCCAAGAACGTGCACATTTTTGTGAGCTGGATGATTGCCCAGAGTGTGACGGCAGTCGCAGGGCTGGTGTCCTACCCCTTTGACACTGTTCGTCGTAGAATGATGATGCAGTCCGGCCGGAAAGGGGCCGATATTATGTACACGGGGACAGTTGACTGCTGGAGGAAGATTGCAAAAGACGAAGGAGCCAAGGCCTTCTTCAAAGGTGCCTGGTCCAATGTGCTGAGAGGCATGGGCGGTGCTTTTGTATTGGTGTTGTATGATGAGATCAAAAAATATGTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0026-Ab Anti-SLC25A4 monoclonal antibody
    Target Antigen GM-Tg-g-IP0026-Ag SLC25A4 protein
    ORF Viral Vector pGMLP002929 Human SLC25A4 Lentivirus plasmid
    ORF Viral Vector vGMLP002929 Human SLC25A4 Lentivirus particle


    Target information

    Target ID GM-IP0026
    Target Name SLC25A4
    Gene ID 291, 11739, 695102, 85333, 101096309, 475630, 282478, 100050762
    Gene Symbol and Synonyms AAC1,ANT,ANT 1,ANT1,mANC1,MTDPS12,MTDPS12A,PEO2,PEO3,PEOA2,SLC25A4,T1
    Uniprot Accession P12235
    Uniprot Entry Name ADT1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000151729
    Target Classification Not Available

    This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.