Human AQP3/AQP-3/GIL ORF/cDNA clone-Lentivirus plasmid (NM_004925)

Cat. No.: pGMLP002932
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AQP3/AQP-3/GIL Lentiviral expression plasmid for AQP3 lentivirus packaging, AQP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to AQP3/AQP-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $519.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002932
Gene Name AQP3
Accession Number NM_004925
Gene ID 360
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 879 bp
Gene Alias AQP-3,GIL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGTCGACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGGCTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGTGGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAACCTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCCCACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAGCTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTTGGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCCAATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGACACTTGGATATGATCAATGGCTTCTTTGACCAGTTCATAGGCACAGCCTCCCTTATCGTGTGTGTGCTGGCCATTGTTGACCCCTACAACAACCCCGTCCCCCGAGGCCTGGAGGCCTTCACCGTGGGCCTGGTGGTCCTGGTCATTGGCACCTCCATGGGCTTCAACTCCGGCTATGCCGTCAACCCTGCCCGGGACTTTGGCCCCCGCCTTTTTACAGCCCTTGCGGGCTGGGGCTCTGCAGTCTTCACGACCGGCCAGCATTGGTGGTGGGTGCCCATCGTGTCCCCACTCCTGGGCTCCATTGCGGGTGTCTTCGTGTACCAGCTGATGATCGGCTGCCACCTGGAGCAGCCCCCACCCTCCAACGAGGAAGAGAATGTGAAGCTGGCCCATGTGAAGCACAAGGAGCAGATCTGA
ORF Protein Sequence MGRQKELVSRCGEMLHIRYRLLRQALAECLGTLILVMFGCGSVAQVVLSRGTHGGFLTINLAFGFAVTLGILIAGQVSGAHLNPAVTFAMCFLAREPWIKLPIYTLAQTLGAFLGAGIVFGLYYDAIWHFADNQLFVSGPNGTAGIFATYPSGHLDMINGFFDQFIGTASLIVCVLAIVDPYNNPVPRGLEAFTVGLVVLVIGTSMGFNSGYAVNPARDFGPRLFTALAGWGSAVFTTGQHWWWVPIVSPLLGSIAGVFVYQLMIGCHLEQPPPSNEEENVKLAHVKHKEQI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86226-Ab Anti-AQP3/ AQP-3/ GIL monoclonal antibody
    Target Antigen GM-Tg-g-T86226-Ag AQP3 VLP (virus-like particle)
    ORF Viral Vector pGMLP002932 Human AQP3 Lentivirus plasmid
    ORF Viral Vector pGMPC000831 Human AQP3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002932 Human AQP3 Lentivirus particle


    Target information

    Target ID GM-T86226
    Target Name AQP3
    Gene ID 360, 11828, 702721, 65133, 101101676, 611792, 780866, 100053851
    Gene Symbol and Synonyms AQP-2,AQP-3,AQP3,GIL
    Uniprot Accession Q92482
    Uniprot Entry Name AQP3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000165272
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.