Human P4HB/CLCRP1/ DSI ORF/cDNA clone-Lentivirus plasmid (NM_000918)

Pre-made Human P4HB/CLCRP1/ DSI Lentiviral expression plasmid for P4HB lentivirus packaging, P4HB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to P4HB/CLCRP1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002953 Human P4HB Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002953
Gene Name P4HB
Accession Number NM_000918
Gene ID 5034
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1527 bp
Gene Alias CLCRP1, DSI, ERBA2L, GIT, P4Hbeta, PDI, PDIA1, PHDB, PO4DB, PO4HB, PROHB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCGCCGCGCTCTGCTGTGCCTGGCCGTGGCCGCCCTGGTGCGCGCCGACGCCCCCGAGGAGGAGGACCACGTCCTGGTGCTGCGGAAAAGCAACTTCGCGGAGGCGCTGGCGGCCCACAAGTACCTGCTGGTGGAGTTCTATGCCCCTTGGTGTGGCCACTGCAAGGCTCTGGCCCCTGAGTATGCCAAAGCCGCTGGGAAGCTGAAGGCAGAAGGTTCCGAGATCAGGTTGGCCAAGGTGGACGCCACGGAGGAGTCTGACCTGGCCCAGCAGTACGGCGTGCGCGGCTATCCCACCATCAAGTTCTTCAGGAATGGAGACACGGCTTCCCCCAAGGAATATACAGCTGGCAGAGAGGCTGATGACATCGTGAACTGGCTGAAGAAGCGCACGGGCCCGGCTGCCACCACCCTGCCTGACGGCGCAGCTGCAGAGTCCTTGGTGGAGTCCAGCGAGGTGGCTGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTCTGCCAAGCAGTTTTTGCAGGCAGCAGAGGCCATCGATGACATACCATTTGGGATCACTTCCAACAGTGACGTGTTCTCCAAATACCAGCTCGACAAAGATGGGGTTGTCCTCTTTAAGAAGTTTGATGAAGGCCGGAACAACTTTGAAGGGGAGGTCACCAAGGAGAACCTGCTGGACTTTATCAAACACAACCAGCTGCCCCTTGTCATCGAGTTCACCGAGCAGACAGCCCCGAAGATTTTTGGAGGTGAAATCAAGACTCACATCCTGCTGTTCTTGCCCAAGAGTGTGTCTGACTATGACGGCAAACTGAGCAACTTCAAAACAGCAGCCGAGAGCTTCAAGGGCAAGATCCTGTTCATCTTCATCGACAGCGACCACACCGACAACCAGCGCATCCTCGAGTTCTTTGGCCTGAAGAAGGAAGAGTGCCCGGCCGTGCGCCTCATCACCCTGGAGGAGGAGATGACCAAGTACAAGCCCGAATCGGAGGAGCTGACGGCAGAGAGGATCACAGAGTTCTGCCACCGCTTCCTGGAGGGCAAAATCAAGCCCCACCTGATGAGCCAGGAGCTGCCGGAGGACTGGGACAAGCAGCCTGTCAAGGTGCTTGTTGGGAAGAACTTTGAAGACGTGGCTTTTGATGAGAAAAAAAACGTCTTTGTGGAGTTCTATGCCCCATGGTGTGGTCACTGCAAACAGTTGGCTCCCATTTGGGATAAACTGGGAGAGACGTACAAGGACCATGAGAACATCGTCATCGCCAAGATGGACTCGACTGCCAACGAGGTGGAGGCCGTCAAAGTGCACAGCTTCCCCACACTCAAGTTCTTTCCTGCCAGTGCCGACAGGACGGTCATTGATTACAACGGGGAACGCACGCTGGATGGTTTTAAGAAATTCCTGGAGAGCGGTGGCCAGGATGGGGCAGGGGATGATGACGATCTCGAGGACCTGGAAGAAGCAGAGGAGCCAGACATGGAGGAAGACGATGATCAGAAAGCTGTGAAAGATGAACTGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1636-Ab Anti-PDIA1/ P4HB/ CLCRP1 functional antibody
    Target Antigen GM-Tg-g-SE1636-Ag P4HB protein
    ORF Viral Vector pGMLP002953 Human P4HB Lentivirus plasmid
    ORF Viral Vector vGMLP002953 Human P4HB Lentivirus particle


    Target information

    Target ID GM-SE1636
    Target Name P4HB
    Gene ID 5034, 18453, 714702, 25506, 101099917, 483369, 281373, 100055188
    Gene Symbol and Synonyms CLCRP1,DSI,ERBA2L,ERp59,GIT,P4HB,P4Hbeta,PDI,PDIA1,PDIR,PHDB,PO4DB,PO4HB,PROHB,Thbp
    Uniprot Accession P07237
    Uniprot Entry Name PDIA1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Contrast - Induced Nephropathy
    Gene Ensembl ENSG00000185624
    Target Classification Not Available

    This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.