Human RS1/RS/ XLRS1 ORF/cDNA clone-Lentivirus plasmid (NM_000330)

Pre-made Human RS1/RS/ XLRS1 Lentiviral expression plasmid for RS1 lentivirus packaging, RS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to RS1/RS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002955 Human RS1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002955
Gene Name RS1
Accession Number NM_000330
Gene ID 6247
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 675 bp
Gene Alias RS, XLRS1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCACGCAAGATAGAAGGCTTTTTGTTATTACTTCTCTTTGGCTATGAAGCCACATTGGGATTATCGTCTACCGAGGATGAAGGCGAGGACCCCTGGTACCAAAAAGCATGCAAGTGCGATTGCCAAGGAGGACCCAATGCTCTGTGGTCTGCAGGTGCCACCTCCTTGGACTGTATACCAGAATGCCCATATCACAAGCCTCTGGGTTTCGAGTCAGGGGAGGTCACACCGGACCAGATCACCTGCTCTAACCCGGAGCAGTATGTGGGCTGGTATTCTTCGTGGACTGCAAACAAGGCCCGGCTCAACAGTCAAGGCTTTGGGTGTGCCTGGCTCTCCAAGTTCCAGGACAGTAGCCAGTGGTTACAGATAGATCTGAAGGAGATCAAAGTGATTTCAGGGATCCTCACCCAGGGGCGCTGTGACATCGATGAGTGGATGACCAAGTACAGCGTGCAGTACAGGACCGATGAGCGCCTGAACTGGATTTACTACAAGGACCAGACTGGAAACAACCGGGTCTTCTATGGCAACTCGGACCGCACCTCCACGGTTCAGAACCTGCTGCGGCCCCCCATCATCTCCCGCTTCATCCGCCTCATCCCGCTGGGCTGGCACGTCCGCATTGCCATCCGGATGGAGCTGCTGGAGTGCGTCAGCAAGTGTGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T54031-Ab Anti-XLRS1/ RS1/ RS functional antibody
    Target Antigen GM-Tg-g-T54031-Ag RS1 protein
    ORF Viral Vector pGMAAV000362 Human RS1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP002955 Human RS1 Lentivirus plasmid
    ORF Viral Vector vGMAAV000362 Human RS1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002955 Human RS1 Lentivirus particle


    Target information

    Target ID GM-T54031
    Target Name RS1
    Gene ID 6247, 20147, 100423325, 100125595, 101088816, 119868374, 615193, 100058084
    Gene Symbol and Synonyms RS,RS1,Rs1h,tmgc1,XLRS1
    Uniprot Accession O15537
    Uniprot Entry Name XLRS1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000102104
    Target Classification Not Available

    This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.