Human RS1/RS/ XLRS1 ORF/cDNA clone-Lentivirus plasmid (NM_000330)
Pre-made Human RS1/RS/ XLRS1 Lentiviral expression plasmid for RS1 lentivirus packaging, RS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RS1/RS products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002955 | Human RS1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002955 |
Gene Name | RS1 |
Accession Number | NM_000330 |
Gene ID | 6247 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 675 bp |
Gene Alias | RS, XLRS1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCACGCAAGATAGAAGGCTTTTTGTTATTACTTCTCTTTGGCTATGAAGCCACATTGGGATTATCGTCTACCGAGGATGAAGGCGAGGACCCCTGGTACCAAAAAGCATGCAAGTGCGATTGCCAAGGAGGACCCAATGCTCTGTGGTCTGCAGGTGCCACCTCCTTGGACTGTATACCAGAATGCCCATATCACAAGCCTCTGGGTTTCGAGTCAGGGGAGGTCACACCGGACCAGATCACCTGCTCTAACCCGGAGCAGTATGTGGGCTGGTATTCTTCGTGGACTGCAAACAAGGCCCGGCTCAACAGTCAAGGCTTTGGGTGTGCCTGGCTCTCCAAGTTCCAGGACAGTAGCCAGTGGTTACAGATAGATCTGAAGGAGATCAAAGTGATTTCAGGGATCCTCACCCAGGGGCGCTGTGACATCGATGAGTGGATGACCAAGTACAGCGTGCAGTACAGGACCGATGAGCGCCTGAACTGGATTTACTACAAGGACCAGACTGGAAACAACCGGGTCTTCTATGGCAACTCGGACCGCACCTCCACGGTTCAGAACCTGCTGCGGCCCCCCATCATCTCCCGCTTCATCCGCCTCATCCCGCTGGGCTGGCACGTCCGCATTGCCATCCGGATGGAGCTGCTGGAGTGCGTCAGCAAGTGTGCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T54031-Ab | Anti-XLRS1/ RS1/ RS functional antibody |
Target Antigen | GM-Tg-g-T54031-Ag | RS1 protein |
ORF Viral Vector | pGMAAV000362 | Human RS1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP002955 | Human RS1 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000362 | Human RS1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP002955 | Human RS1 Lentivirus particle |
Target information
Target ID | GM-T54031 |
Target Name | RS1 |
Gene ID | 6247, 20147, 100423325, 100125595, 101088816, 119868374, 615193, 100058084 |
Gene Symbol and Synonyms | RS,RS1,Rs1h,tmgc1,XLRS1 |
Uniprot Accession | O15537 |
Uniprot Entry Name | XLRS1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000102104 |
Target Classification | Not Available |
This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. [provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.