Human LIPA/CESD/ LAL ORF/cDNA clone-Lentivirus plasmid (NM_001288979)
Pre-made Human LIPA/CESD/ LAL Lentiviral expression plasmid for LIPA lentivirus packaging, LIPA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to LIPA/CESD products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002961 | Human LIPA Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002961 |
Gene Name | LIPA |
Accession Number | NM_001288979 |
Gene ID | 3988 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 852 bp |
Gene Alias | CESD, LAL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCAACAGCAGAGGAAATACCTGGTCTCGGAAACATAAGACACTCTCAGTTTCTCAGGATGAATTCTGGGCTTTCAGTTATGATGAGATGGCAAAATATGACCTACCAGCTTCCATTAACTTCATTCTGAATAAAACTGGCCAAGAACAAGTGTATTATGTGGGTCATTCTCAAGGCACCACTATAGGTTTTATAGCATTTTCACAGATCCCTGAGCTGGCTAAAAGGATTAAAATGTTTTTTGCCCTGGGTCCTGTGGCTTCCGTCGCCTTCTGTACTAGCCCTATGGCCAAATTAGGACGATTACCAGATCATCTCATTAAGGACTTATTTGGAGACAAAGAATTTCTTCCCCAGAGTGCGTTTTTGAAGTGGCTGGGTACCCACGTTTGCACTCATGTCATACTGAAGGAGCTCTGTGGAAATCTCTGTTTTCTTCTGTGTGGATTTAATGAGAGAAATTTAAATATGTCTAGAGTGGATGTATATACAACACATTCTCCTGCTGGAACTTCTGTGCAAAACATGTTACACTGGAGCCAGGCTGTTAAATTCCAAAAGTTTCAAGCCTTTGACTGGGGAAGCAGTGCCAAGAATTATTTTCATTACAACCAGAGTTATCCTCCCACATACAATGTGAAGGACATGCTTGTGCCGACTGCAGTCTGGAGCGGGGGTCACGACTGGCTTGCAGATGTCTACGACGTCAATATCTTACTGACTCAGATCACCAACTTGGTGTTCCATGAGAGCATTCCGGAATGGGAGCATCTTGACTTCATTTGGGGCCTGGATGCCCCTTGGAGGCTTTATAATAAAATTATTAATCTAATGAGGAAATATCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T24373-Ab | Anti-LICH/ LIPA/ CESD functional antibody |
Target Antigen | GM-Tg-g-T24373-Ag | LIPA protein |
ORF Viral Vector | pGMLP002961 | Human LIPA Lentivirus plasmid |
ORF Viral Vector | vGMLP002961 | Human LIPA Lentivirus particle |
ORF Viral Vector | pGMLV002192 | Human LIPA Lentivirus plasmid |
ORF Viral Vector | pGMLV002199 | Human LIPA Lentivirus plasmid |
Target information
Target ID | GM-T24373 |
Target Name | LIPA |
Gene ID | 3988, 16889, 695240, 25055, 101094134, 100856363, 100125267, 100071626 |
Gene Symbol and Synonyms | CESD,Chole,Chole2,LAL,Lip-1,Lip1,LIPA |
Uniprot Accession | P38571 |
Uniprot Entry Name | LICH_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000107798 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.