Human MMP12/HME/ ME ORF/cDNA clone-Lentivirus plasmid (NM_002426)
Pre-made Human MMP12/HME/ ME Lentiviral expression plasmid for MMP12 lentivirus packaging, MMP12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MMP-12/MMP12/HME products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002965 | Human MMP12 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002965 |
Gene Name | MMP12 |
Accession Number | NM_002426 |
Gene ID | 4321 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1413 bp |
Gene Alias | HME, ME, MME, MMP-12 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGTTTCTTCTAATACTGCTCCTGCAGGCCACTGCTTCTGGAGCTCTTCCCCTGAACAGCTCTACAAGCCTGGAAAAAAATAATGTGCTATTTGGTGAAAGATACTTAGAAAAATTTTATGGCCTTGAGATAAACAAACTTCCAGTGACAAAAATGAAATATAGTGGAAACTTAATGAAGGAAAAAATCCAAGAAATGCAGCACTTCTTGGGTCTGAAAGTGACCGGGCAACTGGACACATCTACCCTGGAGATGATGCACGCACCTCGATGTGGAGTCCCCGATGTCCATCATTTCAGGGAAATGCCAGGGGGGCCCGTATGGAGGAAACATTATATCACCTACAGAATCAATAATTACACACCTGACATGAACCGTGAGGATGTTGACTACGCAATCCGGAAAGCTTTCCAAGTATGGAGTAATGTTACCCCCTTGAAATTCAGCAAGATTAACACAGGCATGGCTGACATTTTGGTGGTTTTTGCCCGTGGAGCTCATGGAGACTTCCATGCTTTTGATGGCAAAGGTGGAATCCTAGCCCATGCTTTTGGACCTGGATCTGGCATTGGAGGGGATGCACATTTCGATGAGGACGAATTCTGGACTACACATTCAGGAGGCACAAACTTGTTCCTCACTGCTGTTCACGAGATTGGCCATTCCTTAGGTCTTGGCCATTCTAGTGATCCAAAGGCCGTAATGTTCCCCACCTACAAATATGTTGACATCAACACATTTCGCCTCTCTGCTGATGACATACGTGGCATTCAGTCCCTGTATGGAGACCCAAAAGAGAACCAACGCTTGCCAAATCCTGACAATTCAGAACCAGCTCTCTGTGACCCCAATTTGAGTTTTGATGCTGTCACTACCGTGGGAAATAAGATCTTTTTCTTCAAAGACAGGTTCTTCTGGCTGAAGGTTTCTGAGAGACCAAAGACCAGTGTTAATTTAATTTCTTCCTTATGGCCAACCTTGCCATCTGGCATTGAAGCTGCTTATGAAATTGAAGCCAGAAATCAAGTTTTTCTTTTTAAAGATGACAAATACTGGTTAATTAGCAATTTAAGACCAGAGCCAAATTATCCCAAGAGCATACATTCTTTTGGTTTTCCTAACTTTGTGAAAAAAATTGATGCAGCTGTTTTTAACCCACGTTTTTATAGGACCTACTTCTTTGTAGATAACCAGTATTGGAGGTATGATGAAAGGAGACAGATGATGGACCCTGGTTATCCCAAACTGATTACCAAGAACTTCCAAGGAATCGGGCCTAAAATTGATGCAGTCTTCTACTCTAAAAACAAATACTACTATTTCTTCCAAGGATCTAACCAATTTGAATATGACTTCCTACTCCAACGTATCACCAAAACACTGAAAAGCAATAGCTGGTTTGGTTGTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T03500-Ab | Anti-MMP12/ MMP-12/ HME functional antibody |
Target Antigen | GM-Tg-g-T03500-Ag | MMP-12/MMP12 protein |
ORF Viral Vector | pGMLP002965 | Human MMP12 Lentivirus plasmid |
ORF Viral Vector | vGMLP002965 | Human MMP12 Lentivirus particle |
Target information
Target ID | GM-T03500 |
Target Name | MMP-12 |
Gene ID | 4321, 17381, 703867, 117033, 101084472, 611789, 526981, 100069047 |
Gene Symbol and Synonyms | HME,ME,MME,Mmel,MMP-12,MMP12 |
Uniprot Accession | P39900 |
Uniprot Entry Name | MMP12_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000262406 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease degrades soluble and insoluble elastin. This gene may play a role in aneurysm formation and mutations in this gene are associated with lung function and chronic obstructive pulmonary disease (COPD). This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.