Human MMP12/HME/ ME ORF/cDNA clone-Lentivirus plasmid (NM_002426)

Pre-made Human MMP12/HME/ ME Lentiviral expression plasmid for MMP12 lentivirus packaging, MMP12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to MMP-12/MMP12/HME products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002965 Human MMP12 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002965
Gene Name MMP12
Accession Number NM_002426
Gene ID 4321
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1413 bp
Gene Alias HME, ME, MME, MMP-12
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGTTTCTTCTAATACTGCTCCTGCAGGCCACTGCTTCTGGAGCTCTTCCCCTGAACAGCTCTACAAGCCTGGAAAAAAATAATGTGCTATTTGGTGAAAGATACTTAGAAAAATTTTATGGCCTTGAGATAAACAAACTTCCAGTGACAAAAATGAAATATAGTGGAAACTTAATGAAGGAAAAAATCCAAGAAATGCAGCACTTCTTGGGTCTGAAAGTGACCGGGCAACTGGACACATCTACCCTGGAGATGATGCACGCACCTCGATGTGGAGTCCCCGATGTCCATCATTTCAGGGAAATGCCAGGGGGGCCCGTATGGAGGAAACATTATATCACCTACAGAATCAATAATTACACACCTGACATGAACCGTGAGGATGTTGACTACGCAATCCGGAAAGCTTTCCAAGTATGGAGTAATGTTACCCCCTTGAAATTCAGCAAGATTAACACAGGCATGGCTGACATTTTGGTGGTTTTTGCCCGTGGAGCTCATGGAGACTTCCATGCTTTTGATGGCAAAGGTGGAATCCTAGCCCATGCTTTTGGACCTGGATCTGGCATTGGAGGGGATGCACATTTCGATGAGGACGAATTCTGGACTACACATTCAGGAGGCACAAACTTGTTCCTCACTGCTGTTCACGAGATTGGCCATTCCTTAGGTCTTGGCCATTCTAGTGATCCAAAGGCCGTAATGTTCCCCACCTACAAATATGTTGACATCAACACATTTCGCCTCTCTGCTGATGACATACGTGGCATTCAGTCCCTGTATGGAGACCCAAAAGAGAACCAACGCTTGCCAAATCCTGACAATTCAGAACCAGCTCTCTGTGACCCCAATTTGAGTTTTGATGCTGTCACTACCGTGGGAAATAAGATCTTTTTCTTCAAAGACAGGTTCTTCTGGCTGAAGGTTTCTGAGAGACCAAAGACCAGTGTTAATTTAATTTCTTCCTTATGGCCAACCTTGCCATCTGGCATTGAAGCTGCTTATGAAATTGAAGCCAGAAATCAAGTTTTTCTTTTTAAAGATGACAAATACTGGTTAATTAGCAATTTAAGACCAGAGCCAAATTATCCCAAGAGCATACATTCTTTTGGTTTTCCTAACTTTGTGAAAAAAATTGATGCAGCTGTTTTTAACCCACGTTTTTATAGGACCTACTTCTTTGTAGATAACCAGTATTGGAGGTATGATGAAAGGAGACAGATGATGGACCCTGGTTATCCCAAACTGATTACCAAGAACTTCCAAGGAATCGGGCCTAAAATTGATGCAGTCTTCTACTCTAAAAACAAATACTACTATTTCTTCCAAGGATCTAACCAATTTGAATATGACTTCCTACTCCAACGTATCACCAAAACACTGAAAAGCAATAGCTGGTTTGGTTGTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T03500-Ab Anti-MMP12/ MMP-12/ HME functional antibody
    Target Antigen GM-Tg-g-T03500-Ag MMP-12/MMP12 protein
    ORF Viral Vector pGMLP002965 Human MMP12 Lentivirus plasmid
    ORF Viral Vector vGMLP002965 Human MMP12 Lentivirus particle


    Target information

    Target ID GM-T03500
    Target Name MMP-12
    Gene ID 4321, 17381, 703867, 117033, 101084472, 611789, 526981, 100069047
    Gene Symbol and Synonyms HME,ME,MME,Mmel,MMP-12,MMP12
    Uniprot Accession P39900
    Uniprot Entry Name MMP12_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000262406
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease degrades soluble and insoluble elastin. This gene may play a role in aneurysm formation and mutations in this gene are associated with lung function and chronic obstructive pulmonary disease (COPD). This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.