Human FGG ORF/cDNA clone-Lentivirus plasmid (NM_021870)
Cat. No.: pGMLP002979
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human FGG/ Lentiviral expression plasmid for FGG lentivirus packaging, FGG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
FGG/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002979 |
Gene Name | FGG |
Accession Number | NM_021870 |
Gene ID | 2266 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1362 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGTTGGTCCTTGCACCCCCGGAATTTAATTCTCTACTTCTATGCTCTTTTATTTCTCTCTTCAACATGTGTAGCATATGTTGCTACCAGAGACAACTGCTGCATCTTAGATGAAAGATTCGGTAGTTATTGTCCAACTACCTGTGGCATTGCAGATTTCCTGTCTACTTATCAAACCAAAGTAGACAAGGATCTACAGTCTTTGGAAGACATCTTACATCAAGTTGAAAACAAAACATCAGAAGTCAAACAGCTGATAAAAGCAATCCAACTCACTTATAATCCTGATGAATCATCAAAACCAAATATGATAGACGCTGCTACTTTGAAGTCCAGGAAAATGTTAGAAGAAATTATGAAATATGAAGCATCGATTTTAACACATGACTCAAGTATTCGATATTTGCAGGAAATATATAATTCAAATAATCAAAAGATTGTTAACCTGAAAGAGAAGGTAGCCCAGCTTGAAGCACAGTGCCAGGAACCTTGCAAAGACACGGTGCAAATCCATGATATCACTGGGAAAGATTGTCAAGACATTGCCAATAAGGGAGCTAAACAGAGCGGGCTTTACTTTATTAAACCTCTGAAAGCTAACCAGCAATTCTTAGTCTACTGTGAAATCGATGGGTCTGGAAATGGATGGACTGTGTTTCAGAAGAGACTTGATGGCAGTGTAGATTTCAAGAAAAACTGGATTCAATATAAAGAAGGATTTGGACATCTGTCTCCTACTGGCACAACAGAATTTTGGCTGGGAAATGAGAAGATTCATTTGATAAGCACACAGTCTGCCATCCCATATGCATTAAGAGTGGAACTGGAAGACTGGAATGGCAGAACCAGTACTGCAGACTATGCCATGTTCAAGGTGGGACCTGAAGCTGACAAGTACCGCCTAACATATGCCTACTTCGCTGGTGGGGATGCTGGAGATGCCTTTGATGGCTTTGATTTTGGCGATGATCCTAGTGACAAGTTTTTCACATCCCATAATGGCATGCAGTTCAGTACCTGGGACAATGACAATGATAAGTTTGAAGGCAACTGTGCTGAACAGGATGGATCTGGTTGGTGGATGAACAAGTGTCACGCTGGCCATCTCAATGGAGTTTATTACCAAGGTGGCACTTACTCAAAAGCATCTACTCCTAATGGTTATGATAATGGCATTATTTGGGCCACTTGGAAAACCCGGTGGTATTCCATGAAGAAAACCACTATGAAGATAATCCCATTCAACAGACTCACAATTGGAGAAGGACAGCAACACCACCTGGGGGGAGCCAAACAGGTCAGACCAGAGCACCCTGCGGAAACAGAATATGACTCACTTTACCCTGAGGATGATTTGTAG |
ORF Protein Sequence | MSWSLHPRNLILYFYALLFLSSTCVAYVATRDNCCILDERFGSYCPTTCGIADFLSTYQTKVDKDLQSLEDILHQVENKTSEVKQLIKAIQLTYNPDESSKPNMIDAATLKSRKMLEEIMKYEASILTHDSSIRYLQEIYNSNNQKIVNLKEKVAQLEAQCQEPCKDTVQIHDITGKDCQDIANKGAKQSGLYFIKPLKANQQFLVYCEIDGSGNGWTVFQKRLDGSVDFKKNWIQYKEGFGHLSPTGTTEFWLGNEKIHLISTQSAIPYALRVELEDWNGRTSTADYAMFKVGPEADKYRLTYAYFAGGDAGDAFDGFDFGDDPSDKFFTSHNGMQFSTWDNDNDKFEGNCAEQDGSGWWMNKCHAGHLNGVYYQGGTYSKASTPNGYDNGIIWATWKTRWYSMKKTTMKIIPFNRLTIGEGQQHHLGGAKQVRPEHPAETEYDSLYPEDDL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T26144-Ab | Anti-FIBG/ FGG monoclonal antibody |
Target Antigen | GM-Tg-g-T26144-Ag | FGG VLP (virus-like particle) |
ORF Viral Vector | pGMLP002979 | Human FGG Lentivirus plasmid |
ORF Viral Vector | vGMLP002979 | Human FGG Lentivirus particle |
Target information
Target ID | GM-T26144 |
Target Name | FGG |
Gene ID | 2266, 99571, 698363, 24367, 101092680, 475474, 280792, 100147221 |
Gene Symbol and Synonyms | 3010002H13Rik,FGG |
Uniprot Accession | P02679 |
Uniprot Entry Name | FIBG_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Malignant neoplasm of colon, Acute pancreatitis, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000171557 |
Target Classification | Not Available |
The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.